http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Lzuzx&year=&month=
2014.igem.org - User contributions [en]
2024-03-29T15:28:43Z
From 2014.igem.org
MediaWiki 1.16.5
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:58:23Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: center;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3688px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3577px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p><br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURES OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><p>&nbsp;</p><br />
<p>&nbsp;</p> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&gt;nahR naphthalene degradation LysR-family transcriptional activator 903bp<br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:56:38Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: center;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3688px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3577px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p><br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURES OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><p>&nbsp;</p><br />
<p>&nbsp;</p> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&gt;nahR naphthalene degradation LysR-family transcriptional activator 903bp<br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:50:20Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: center;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3688px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3577px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p><br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><p>&nbsp;</p><br />
<p>&nbsp;</p> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&gt;nahR naphthalene degradation LysR-family transcriptional activator 903bp<br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:49:36Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: center;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3588px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p><br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><p>&nbsp;</p><br />
<p>&nbsp;</p> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&gt;nahR naphthalene degradation LysR-family transcriptional activator 903bp<br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:48:07Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: center;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p><br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><p>&nbsp;</p><br />
<p>&nbsp;</p> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&gt;nahR naphthalene degradation LysR-family transcriptional activator 903bp<br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:46:27Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: center;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p><br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p>&gt;nahR naphthalene degradation LysR-family transcriptional activator 903bp<br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:42:02Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p><br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:41:16Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
font-size: 10px;<br />
}<br />
#apDiv3 table tr td table tr td table tr td {<br />
font-size: 10px;<br />
text-align: left;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="48"><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;PARTS SEQUENCES</div></td><br />
</tr><br />
</table><br />
<p><br /><br />
ATGGAACTGCGTGATCTGGATTTAAACCTGCTGGTGGTGTTCAACGAGCTGCTGGTCTGCAGACGCGTCTCTATCGTTGCCGAGAACCTGGGCCTGACCCAGCCTGCTGTCAGCAATGCGCTGAAACGCCTGCGCACAGCGCTACAGGACCAACTTTTCGTGCGCACCTACCAGGGTATGGAACCCACACCCTACGCCGCGAACTTGGCCGAGCCCGTCGCCTTGGCCATGCACGCCCTGCGCGAAGCCCTGCAGCACCATGAGCGCTTCGATCCGCTGACCAGCGAGCGTACTTTCACCCTGGCCATGACCGACATCGGCGAGATCTACTTCATGCCGCGGCTGATGGATGCGATTACTCTTCAAGCCCCCAATTGCGCGATCAGCACCGTGCGCGACAGTTCGATGAGCCTGATGCAAGCCTTGCAGAACGGCACAGTGGACCTAGCCGTGGGCCTGCTGCCCAACCTGCAGACTGGCTTCTTCCAGCGCCGGCTGCTCCACAATCACTACGTGTGCCTGTGTCGCAAGGACCATCCGGCCACCCGCGAACCCCTGACTCTTGAGCGCTTCTGTTCCTATGGCCACGTGCGTGTCATCGCCGCTGGCACAGGCCACGGCGAGGTGGACACATACTTGACGAAGGCCGGCATCCGGCGCGACATCCGCCTGGAGGTGCCGCACTTCGTCGCCGTTGGCCACATACTCCAGCGCACCGAGCTGATCGCCACTGTGCCGATACGTTTCGCCGACTGCTGCGTAGAGCCCTTCGGTCTGAGCGTCTTGCCGCACCCAGTCGCCTTGCCGGAAATCGCCATCAACATGTTCTGGCATGCGAAATACCACCAGGACCTCGCCAATATCTGGTTGCGGCAACTGATGTTCGACCTGTTTTCTGATTGA</p><br />
<p>&gt;nahE trans-o-hydroxybenzylidenepyruvate hydratase-aldolase 1005bp<br /><br />
ATGTCGAATAAAATTATGAAAACGTCGCGTCTTACCGCCGAAGATATCAACGGCGCCTGGACTATAATGCCCACACCCTCGACGCCTGATGCTTCTGATTGGCGCAGCACTGCCACCGTGGACTTAGAAGAGACTGCCCGCATAGTTGAAGAGCTGATTGCAGCTGGTGTCAACGGTATTCTAAGTATGGGTACTTTTGGTGAGTGCGCCACGTTGACCTGGGATGAAAAACGTGATTATGTCTCGACGATTGTCGAGACCATTCGTGGTCGCGTGCCTTATTTCTGTGGCACGACAGCCTTAAATACCCGAGAAGTCATCCGCCAGACCCGAGAGCTTATCGATATTGGCGCCAACGGCACTATGCTCGGGGTGCCGATGTGGGTGAAGATGGACCTGCCTACAGCGGTTCAGTTCTATCGTGATGTTGCAGATGCGGTACCAGAGGCTGCCATTGCGATTTACGCCAACCCCGAAGCATTCAAGTTCGACTTCCCTCGCCCATTCTGGGCAGAGATGTCCAAAATTCCGCAGGTAGTGACTGCGAAGTATCTAGGCATCGGAATGCTTGACTTGGACCTGAGACTGGCACCCAACATCCGCTTCCTTCCCCACGAAGATGACTATTACGCGGCCGCACGCATCAATCCCGAGCGCATAACCGCGTTCTGGTCAAGCGGGGCCATGTGCGGCCCGGCTACCGCCATCATGTTGCGTGACGAAGTGGTGCGGGCCAAGAGCACCGGTGACTGGGCCAAGGCCAAAGCCATCTCCGATGATATGCGTGCAGCCGACTCGACATTGTTTCCGCGTGGCGACTTTTCGGAGTTCTCGAAGTATAATATCGGGCTTGAAAAGGCACGGATGGATGCGGCTGGTTGGCTCAAGGCTGGGCCCTGCCGTCCGCCCTACAACCTTGTTCCAGAAGACTACCTCGCTGGTGCACAGAAATCAGGCAAGGCTTGGGCCGCGCTGCACGCTAAATACAGTAATGAATTGAAGTAG</p><br />
<p>&gt;nahG salicylate hydroxylase 1305bp<br /><br />
ATGAAAAACAATAAACCTGGCTTGCGCATCGGTATCATCGGCGGCGGGATTTCCGGCGTTGCCTTGGCTCTGGAGCTCTGTCGCTACTCCCATCTCCAAGTACAGCTGTTCGAGTGCGCGCCGGCTTTTGGTGAGGTCGGTGCAGGAGTTTCCTTTGGCCCCAACGCGGTGCGCGCCATTGTCGGCCTAGGCTTGGGCGAGGCCTACTTGCAGGTCGCCGACCGTACCTCGGAGCCCTGGGAGGACGTGTGGTTCGAGTGGCGGCGCGGCAGGGATGCCAGCTATCTGGGAGCGACCATCGCTCCGGGCGTGGGCCAGTCCTCGGTACACCGGGCGGATTTCCTCGATGCCCTAGTAAATCACCTCCCAAAAGGTATCGCCCAATTCAGGAAGCGCGCCACACAGGTCGAGCAAAAGGGGGGCGAAGTGCAAGTGCTATTCGCCGACGGCACAGAGCACCGCTGTGACCTTCTAATCGGTGCCGACGGAATCAAGTCAGCGCTGCGTAGTCATGTGCTGGAAGGTCAGGGGCTGGCCCCACAGGTACCGCGCTTCAGCGGCACCTGTGCCTATCGGGGGATGGTCGACAGCCTACACCTGCGCGAAGCCTATCGAGCCCAGGGCATCGACGAGCACTTGGTGGACGTACCGCAGATGTACCTAGGGCTTGACGGCCATATCCTCACTTTTCCGGTGAGGAATGGCCGCCTCATCAACGTTGTGGCCTTCATTTCCGACCGTAGTGAGCCGAAGCCGAACTGGCCCGCGGATGCCCCTTGGGTGCGCGATGTGAGCCAGCGAGAGATGCTCGATGCCTTCGCGGGTTGGGGTGATGCCGCGCGCACCCTGCTGGAGTGCATCCCGGCACCAACTCTCTGGGCACTGCACGACCTGGCGGAGCTGCCGGGCTACGTGCACGGGCGGGTCGTCCTGATCGGCGACGCAGCTCACGCCATGCTGCCGCACCAAGGCGCCGGTGCCGCCCAAGGACTTGAGGACGCCTACTTCCTCGCCCGCCTGTTGGGCGATACCCAAGTCGATGCAGACAACCTCGCCGAGCTGCTTGAAGCCTACGACGACCTGCGCCGCCCTCGTGCCTGTCGCGTGCAGCGAACCTCCCGGGAGACCGGCGAGTTATACGAGTTTCGCGACCCCGTCGTAGGTGCGAACGAGCATCTGCTGGGGGAAAACCTGGCGACCCGCTTCGACTGGCTGTGGAGCCACGACCTCGACGCCGACCTGGCCGAGGCACGTGCGCGCCTGGGTTGGGAAAATGGTAGCCGGGGTGTGCTACGTCAAGGGTGA</p><br />
<p>&gt;ChrR chromate reductas 666 bp<br /><br />
ATGAAAAAAATAGTCCAGTCGGAAGGTTTTCGGTTCTCCGCTGGTCCAATTGTTCGCCCGATCATCTATAAATGGGGCTCCCTTGAACCCATCGTCGAGAAGTGTCCAATGAGTAATGTCTACACCGTGGCCGTTTTAGTGGGGAGCCTGCGCAAGGCTTCGATCAATCGCAAGCTGGCTCTGGCCCTGGCGGATCTGGCGCCGAGCAACCTGAAGCTGGAAATCATCGAGATAGGCGACCTGCCGCTCTACAACGAAGATATTGACGTCACACCCCCACCAGCCTACAGCACTTTCCGTGAGCAGGTTGGCGCGGCCGACGCATTGCTGTTTGTCACGCCTGAATACAACCGCTCGGTTCCGGCCCCGATGAAAAATGCCATTGACGTCGGCTCGCGGCCTTACGGCAAGAGCTGCCTGAGCGGTAAACCGGGTGCGGTGATCAGTGCCTCGCCGGGAGCCATGGGTGGTTTCGGCGCCAATCATCATTTGCGCCAGTCCCTGGTTTTCCTCGATGTGCCTTGCATGCAACAGCCGGAGGCTTATCTGGCCGGTGCGGGGAGCGCGTTCGATGAGCAGGGCGAGCTGTCTGAGTCGGTGAGGCCGTTTCTGCAGAAATTCATTGATGCCTATGGCAAGTGGGTTGAACAGCACAAAAAGGCCTGA</p><br />
<p>&gt;BBa_K1523101 Part-only sequence (3726 bp)<br /><br />
TTCCCATCTATAATCCTCCCTGATTCTTCGCTGATATGGTGCTAAAAAGTAACCAATAAATGGTATTTAAAATGCAAATTATCAGGCGTACCCTGAAACG<br /><br />
TACTAGAGATTAAAGAGGAGAAATACTAGATGAATTGGTCAGTACTCGATAACCAAATGATGAGCCGAGCTATTCAATTGGCTCGCAAAGGATTTTATAC<br /><br />
CACTCGCCCCAATCCCAGTGTGGGCTGCGTTATCGTTAACGATAACCAGATTGTCGGTGAAGGTTATCATCAAAAAGCCGGAGAGCCCCACGCTGAAGTG<br /><br />
CATGCGCTGCGCATGGCTGGCGAGCTTGCCCGTGGCGCGACTGCTTATGTCACCTTAGAACCCTGTAGCCATTATGGTCGTACGCCGCCCTGCGCCTTGG<br /><br />
CGCTGATCAATATTGGTGTAAAGCGGGTGGTGGTGGCGGTTGAAGATCCTAATCCGCAGGTCGGCGGGCGCGGTATTCAAATGCTGCGCGATGCGGGTAT<br /><br />
TCAAGTGGATGTGGGCTTGCATCGTGATGAGGCCTATGCCTTAAATCTTGGTTTTATGAAGCGCATGGAGTCGGGTCTACCTTGGGTGACGGTAAAGCTT<br /><br />
GCCGCGAGTCTTGATGGTAAAACTGCGTTATCAAACGGGGTGTCTAAATGGATCACTGGCCCTGAAGCTCGCCGCGATGTGCAGCGCTTAAGATTACGAT<br /><br />
CCTGCGCGCTGATCACGGGGATTGAAACGGTACTGGCCGATGATCCATCGCTCAATGTGCGCTACTCAGAGCTTGGCAGTTTAAGAGCGCAATTGAGTGA<br /><br />
GTCGCAGGTTTTACAGCCGCTGCGAGTGGTTTTGGACAGTCGCGCCCGCATGCCTATCACGGCAGCATTGTTTGCGATTGAATCACCCATTTTATTAGTC<br /><br />
TCGACAGTGAGCTATTCGTCAGACTTTATGGTGCAATTACCCGCCCATGTGACTTGCCTCCAATTACCAGCCATTGAGGGTCGAATCTCCTTGTCTGCAC<br /><br />
TATTAAGCTATTTAGGCAAAAGCTGTAATCAGGTGCTTATCGAAGCGGGCGCGACTTTAGCTGGCGCCTTTATCGGCTCAGGATTAGCCGATGAATTAGT<br /><br />
GCTTTATCAAGCGATGAAAATCCTTGGCGGCCAAGGACGTAATCTACTTGAATTACCCGATTATCAAATGATGGCCGATATTCCGACCCTCAAATTGGTC<br /><br />
GACGAGCGTAAAGTGGGCGCGGATACGCGCTTCACCTTGAGGCTCGAGTCCAATCCATCTTTAGCGAATAAGTGAGTTAACCATGTTTACTGGGATTATT<br /><br />
GAGGCCGTTGGTACACTGCGAAAGCTTGAGCGTAAAGGCGATGATATTCGCTTAACGGTCGCCAGTGGCAAACTGGATTTAACCGATGTGCGTTTAGGCG<br /><br />
ACAGTATCGCCACCAACGGTGTATGTTTGACCGTGGTTCAACAGTTAGCCGATGGCTATGTGGCTGATGTGTCAGCTGAAACCGTCAGCCTTACAGGTTT<br /><br />
TGCAAACTATAAAGTGGGTACTAAGGTCAATCTTGAAAAGGCCGTCACCCCAACTACTCGTTTAGGCGGCCATATGGTGAGTGGTCATGTGGATGGGATT<br /><br />
GCTACTGTTGAGCAGCGTCTTGCTCGTGGTCAAGCAATCGAATTTTGGTTAGCGGCTCCCACGGAGCTTGCTCGCTATATTGCCCATAAAGGTTCTATCA<br /><br />
CGATTGATGGCGTGAGCCTGACAGTAAACGAAGTCGATGGACACCGTTTTCGATTAACGATTGTGCCCCATACTGTAGGTGAAACCACGTTGGTGGATTT<br /><br />
AAAAGCAGGCGATAAGGTCAATATTGAAGTGGACTTAATTGCCCGTTATTTAGAGCGTTTAATGCGTTTTGACAGCAAAGAAACCCAAGGCGGAGGGGTG<br /><br />
ACCATGGAAATGTTAGCCCGTGCTGGCTTTGTGCGTTAGTACACTGGCACTCAGTTCACTTAGGTATAGAATTTATAACAACAGTCACATTATAAAGGTC<br /><br />
CTACAATGGCGCTGCACAGTATAGAAGAGATCATCGAGGATATTCGTCAAGGCAAAATGGTTATTTTGATGGATGACGAGGACAGAGAAAACGAAGGCGA<br /><br />
TCTGATTTTGGCGGCCGAAATGGTGACGCCAGAAGCGATTAACTTTATGGCGAAATACGGCCGCGGGTTAATCTGCCAAACGATGACCAAGGCCCGTTGC<br /><br />
CAGCAGTTAAATCTGCCCTTGATGGTAACCAATAACAATGCGCAGTTCTCGACCAACTTTACGGTATCGATTGAAGCTGCCGAAGGCGTAACCACAGGGA<br /><br />
TTTCGGCCCACGATCGCGCTGTAACCGTTAAAGCGGCCGTAGCAAAAGATGCTAAAGCGTCGGACTTAGTTCAGCCTGGGCATATCTTCCCGTTAATGGC<br /><br />
GCAGGATGGTGGCGTATTAACCCGCGCAGGTCACACTGAAGCGGGCTGTGATTTAGCCCGTTTAGCAGGGCTTGAACCATCGGGGGTGATTGTTGAAATT<br /><br />
TTGAACGAAGACGGCACTATGGCCCGTCGCCCAGATTTAGAGATTTTCTCTGAAAAACATGGCATTAAAATCGGCACTATTGCGGCCCTGATTGAATACC<br /><br />
GTAATACCAAAGAAACGACCGTTGTGCGTGAAGCCAAATGCAAACTGCCAACCCGTTTCGGTGAGTTCGATATGGTGACCTTTAGGGATACTATCGACAA<br /><br />
TCAATTGCACTTTGCCTTAGTGAAAGGCGAGGTGAAGCCTGACTGTTTAGTACGGGTACATTTACAGAATACCTTTAACGATCTACTTCACTCTGAGCGT<br /><br />
GATCAGCAACGTAGCTGGCCGCTCGAAAAAGCGATGGCGCGGATTTCTGCCGAAGGTGGTGTATTAGTACTGCTTGGCAATCAGGAACATTCCAGTGAAA<br /><br />
TCCTCGCCAAAGTCAAAGCCTTTGAAGCGGAAGATCAAGGTCAGACCCCAGTATCGGCTAAATGGCAAGGCACCTCACGCCGTGTAGGTGTGGGTTCGCA<br /><br />
AATCCTCGCCAGTTTAGGCGTGACAAAAATGCGACTCTTAAGCTCGCCCAAACGTTATCACTCACTTTCAGGCTTTGGCCTTGAAGTGACCGAATGCGTA<br /><br />
GCTGAGTAACAGGTTAAGCTTGTAATAGGTTGCACTAAGGTAAAATTAACCATTTCTATCATTTGCATAAGGCCGCGGGCAATTGACTGTGGTATCATGT<br /><br />
CGCCACTTTTCGCCCAGAGCTGGGTGCTTTAGCTAAATTAGGTAAGAAAATGAACGTAGTTCAAGGTAATATCGAAGCGAAGAATGCCAAAGTTGCGATT<br /><br />
GTAATTTCGCGTTTTAACAGCTTTTTAGTCGAAAGCCTGCTTGAAGGTGCACTTGACACGCTGAAACGTTTTGGCCAAGTCAGTGATGAAAACATCACTG<br /><br />
TTGTCCGTGTACCTGGTGCGGTTGAGTTACCGCTGGCTGCACGTCGTGTTGCCGCAAGTGGTAAGTTTGACGGTATTATTGCACTTGGTGCGGTAATCCG<br /><br />
TGGTGGTACCCCTCACTTTGATTTTGTTGCAGGCGAATGTAACAAAGGTCTGGCTCAAATTGCATTAGAGTTCGATCTGCCCGTTGCTTTCGGTGTATTG<br /><br />
ACTACAGATACCATTGAACAAGCTATTGAGCGTTCAGGTACTAAAGCGGGTAACAAAGGCGGCGAAGCTGCTCTAAGCTTGCTTGAAATGGTCAACGTTC<br /><br />
TGCAACAGCTTGAACAACAGTTGTAA<br /><br />
</p><br />
<p>&gt;yieF chromate reductas 560 bp<br /><br />
ATGTCTGAAAAATTGCAGGTGGTTACGTTACTGGGGAGCCTGCGCAAAGGCTCATTTAATGGCATGGTTG<br /><br />
CACGTACCCTGCCGAAAATTGCTCCGGCGAGCATGGAAGTCAATGCGTTACCATCCATTGCCGACATTCC<br /><br />
CTTGTATGACGCTGACGTACAGCAGGAAGAAGGTTTTCCAGCAACGGTTGAAGCTCTGGCGGAACAGATC<br /><br />
CGTCAGGCTGACGGTGTGGTGATCGTCACGCCGGAATATAACTACTCGGTACCGGGTGGGCTGAAAAATG<br /><br />
CCATCGACTGGCTTTCCCGCCTGCCGGATCAACCGCTGGCCGGTAAACCGGTATTGATTCAGACCAGCTC<br /><br />
AATGGGCGTGATTGGCGGCGCGCGCTGTCAGTATCACCTGCGCCAGATTCTGGTTTTCCTCGATGCAATG<br /><br />
GTGATGAACAAGCCGGAATTTATGGGCGGCGTGATTCAGAACAAAGTTGATCCGCAAACCGGAGAAGTGA<br /><br />
TTGATCAGGGTACGCTGGACCACCTGACCGGGCAATTGACCGCATTTGGTGAGTTTATTCAGCGAGTTAA<br /><br />
GATCTAA</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:33:14Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td table tr td {<br />
text-align: center;<br />
font-size: 14px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="5%" height="408">&nbsp;</td><br />
<td width="90%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="100%" border="2" align="center" cellpadding="0" cellspacing="0"><br />
<col width="72" /><br />
<col width="139" /><br />
<col width="96" /><br />
<col width="72" span="3" /><br />
<col width="244" /><br />
<col width="72" /><br />
<col width="333" /><br />
<tr><br />
<td width="72">No</td><br />
<td width="139">Part No.</td><br />
<td width="96">NCBI No.</td><br />
<td width="72">Resistance</td><br />
<td width="72">Vector</td><br />
<td width="72">Gene Name</td><br />
<td width="244">Gene function</td><br />
<td width="72">Length</td><br />
<td width="333">Website (NCBI)</td><br />
</tr><br />
<tr><br />
<td>1</td><br />
<td>BBa_K1523021</td><br />
<td>NC_004999.1</td><br />
<td>Chl</td><br />
<td>pSB1C3</td><br />
<td>nahR</td><br />
<td width="244">nahE&nbsp;coding sequence, <br /><br />
encoding a LysR-type transcriptional regulator</td><br />
<td>903 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/1343208">http://www.ncbi.nlm.nih.gov/gene/1343208</a></td><br />
</tr><br />
<tr><br />
<td>2</td><br />
<td>BBa_K1523022</td><br />
<td width="96">NC_007926.1<br /><br />
(37386..38381)</td><br />
<td>Chl</td><br />
<td>pSB1C4</td><br />
<td>nahE</td><br />
<td>nahE&nbsp;coding sequence</td><br />
<td>1005 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974214">http://www.ncbi.nlm.nih.gov/gene/3974214</a></td><br />
</tr><br />
<tr><br />
<td>3</td><br />
<td>BBa_K1523023</td><br />
<td width="96">NC_007926.1<br /><br />
(44492..45796)</td><br />
<td>Chl</td><br />
<td>pSB1C5</td><br />
<td>nahG</td><br />
<td>nahG&nbsp;coding sequence</td><br />
<td>1305 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/3974216">http://www.ncbi.nlm.nih.gov/gene/3974216</a></td><br />
</tr><br />
<tr><br />
<td>4</td><br />
<td>BBa_K1523025</td><br />
<td>NC_017530.1</td><br />
<td>Chl</td><br />
<td>pSB1C6</td><br />
<td>chrR</td><br />
<td>chrR&nbsp;coding sequence</td><br />
<td>666 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12519943</a></td><br />
</tr><br />
<tr><br />
<td>5</td><br />
<td>BBa_K1523101</td><br />
<td>N/A</td><br />
<td>Chl</td><br />
<td>pSB1C7</td><br />
<td>PyeaR</td><br />
<td>PyeaR-&gt;Riboflavin synthase</td><br />
<td>3726 bp</td><br />
<td>N/A</td><br />
</tr><br />
<tr><br />
<td>6</td><br />
<td>BBa_K1523008</td><br />
<td>NC_007779.1</td><br />
<td>Chl</td><br />
<td>pSB1C8</td><br />
<td>Yief</td><br />
<td>yieF&nbsp;coding sequence</td><br />
<td>560 bp</td><br />
<td><a href="http://www.ncbi.nlm.nih.gov/gene/12519943">http://www.ncbi.nlm.nih.gov/gene/12933177</a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="5%">&nbsp;</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="65"> <div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%" height="408">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p><br /><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Parts
Team:LZU-China/Parts
2014-10-18T03:07:06Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:388px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 17px;<br />
text-align: left;<br />
line-height: 35px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:1977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv3 table tr td table tr td p {<br />
font-size: 17px;<br />
text-align: center;<br />
}<br />
#apDiv3 table tr td p {<br />
text-align: center;<br />
font-size: 18px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/0/0a/4.parts.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;SUMMARY OF THE PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="22%" height="408">&nbsp;</td><br />
<td width="56%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<table width="653" border="1" align="center" cellpadding="0" cellspacing="0"><br />
<tr><br />
<td width="34"><p align="center">1</p></td><br />
<td width="134"><p align="center">BBa_K1523021</p></td><br />
<td width="72"><p align="center">pSB1C3</p></td><br />
<td width="52"><p align="center">C</p></td><br />
<td width="266"><p align="center"><em>nahR</em> coding sequence,encoding a <em>LysR</em>-type transcriptional regulator </p></td><br />
<td width="95"><p align="center"><em>903bp</em></p></td><br />
</tr><br />
<tr><br />
<td width="34"><p align="center">2</p></td><br />
<td width="134"><p align="center">BBa_K1523022</p></td><br />
<td width="72"><p align="center">pSB1C3</p></td><br />
<td width="52"><p align="center">C</p></td><br />
<td width="266"><p align="center"><em>nahE</em> coding sequence </p></td><br />
<td width="95"><p align="center"><em>1005bp</em></p></td><br />
</tr><br />
<tr><br />
<td width="34"><p align="center">3</p></td><br />
<td width="134"><p align="center">BBa_K1523023</p></td><br />
<td width="72"><p align="center">pSB1C3</p></td><br />
<td width="52"><p align="center">C</p></td><br />
<td width="266"><p align="center"><em>nahG</em> coding sequence </p></td><br />
<td width="95"><p align="center"><em>1305bp</em></p></td><br />
</tr><br />
<tr><br />
<td width="34"><p align="center">4</p></td><br />
<td width="134"><p align="center">BBa_K1523025</p></td><br />
<td width="72"><p align="center">pSB1C3</p></td><br />
<td width="52"><p align="center">C</p></td><br />
<td width="266"><p align="center"><em>chrR</em> coding sequence </p></td><br />
<td width="95"><p align="center"><em>566bp</em></p></td><br />
</tr><br />
<tr><br />
<td width="34"><p align="center">5</p></td><br />
<td width="134"><p align="center">BBa_K1523101</p></td><br />
<td width="72"><p align="center">pSB1C3</p></td><br />
<td width="52"><p align="center">C</p></td><br />
<td width="266"><p align="center"><em>PyeaR</em>-&gt;Riboflavin synthase </p></td><br />
<td width="95"><p align="center"><em>3726bp</em></p></td><br />
</tr><br />
<tr><br />
<td width="34"><p align="center">6</p></td><br />
<td width="134"><p align="center">BBa_K1523008</p></td><br />
<td width="72"><p align="center">pSB1C3</p></td><br />
<td width="52"><p align="center">C</p></td><br />
<td width="266"><p align="center"><em>yieF</em> coding sequence </p></td><br />
<td width="95"><p align="center"><em>560bp</em></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GEL PICTURE OF SOME PARTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="22%" height="408">&nbsp;</td><br />
<td width="56%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/c/c0/Partpic1.png" width="560" height="378" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/e0/Partpic2.png" width="451" height="419" /></p><br />
<p>Fig.2 The picture of K1523101. 1,3: pSB1C3 with K1523101 cut by EcoRI; 2,4: pSB1C3 with K11523101 cut by EcoRI and HindIII; 5: pSB1C3 with K1523101 not be cut.</p><br />
<p></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p><br /><br />
</p></td><br />
<td width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/File:Partpic2.png
File:Partpic2.png
2014-10-18T03:04:46Z
<p>Lzuzx: uploaded a new version of &quot;File:Partpic2.png&quot;</p>
<hr />
<div></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Attribution
Team:LZU-China/Attribution
2014-10-18T00:54:02Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2588px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:2477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 16px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2245px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ATTRIBUTION</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="180"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="70%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to make sure our work can be carried out more efficiently, the members of our whole team are divided into three Groups, Wet Lab Group A,Wet Lab Group B group and Dry Lab Group. Each group has different missions. Wet Lab Group A's work is constructing new parts and synthetic bacteria. Group B's work is designing and running the MFC devices. Dry Lab Group's work is building the automatic monitor system ,building team cultural and team publicity.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/e/e9/Wla.png" alt="" width="325" height="325" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Wet Lab Group A</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Wet lab group A is </span><span lang="EN-US" xml:lang="EN-US"> actually one part of our team whose duties are parts and synthetic bacteria constructions. What's more they are also in charge of our interlab.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Qi Wu(*) , Haotian Wang , Ruixue Zhao , Shengcang Zhu</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiangkai Li</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Advisers:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rong Xu , Haiying Huang</p><br />
<p>&nbsp;</p><br />
<p>* Qi Wu is the leader of the wet lab gruop A.</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="336"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Wet Lab Group B</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Wet lab group B 's responsibilities are to </span>design MFC device , run it<span lang="EN-US" xml:lang="EN-US"> and give the </span>data which can tell the relationship between the contaminants concentrations and and the MFC output voltage.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Liyang Song(*) , Biyao Zhong , Hongxia Zhao , Yating Wang </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp; Xiangkai Li</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Advisers:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Zhengjun Chen , Yaxin Pei </p><br />
<p>&nbsp;</p><br />
<p>* Liyang Song is the leader of the wet lab group B.</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/f/f3/Wlb.png" alt="" width="310" height="310" /></p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="33%"><img src="https://static.igem.org/mediawiki/2014/1/13/Rlg.png" alt="" width="317" height="318" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Dry Lab Group</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Dry lab group </span>is in charge of all kinds of work outside the wet lab. In most cases, they are engaged in dealing with following responsibilities, such as programing , building the automatic monitor system, preparing scientific reports, building team cultural team publicity and huam practice.</p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Xuejing Du(*) , Xiao Zhang(**) , Wanxiang Liu , Xiaofeng Xu</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Yongxing He</p><br />
<p>&nbsp; </p><br />
<p>* Xuejing Du is our human practice manager. He designed our questionnaires. What's more he drew all the wiki materials and designed our posters.</p><br />
<p>** Xiao Zhang is our chief information officer. He developed the monitor program, and build the automatic monitor system. In addition, he is also in charge of our wiki editing.</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/c/c4/Instructorsb.png" alt="" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/ce/Acknob.png" alt="" width="388" height="90" /></a></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="http://ntu.so/di/HI83E/dibluebar.png" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><a href="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></a></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Instructors
Team:LZU-China/Instructors
2014-10-18T00:52:30Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5088px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:4977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2445px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INSTRUCTORS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1419"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/9/97/Fenghuyuan.jpg" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Vice dean Prof Huyuan Feng </span></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Huyuan Feng, Doctor of philosophy graduated in Lanzhou University, as the Vice Dean of School of Life Sciences, Lanzhou University, China will lead this team.&nbsp; His present research subject is microbio strains living on Dunhuang Mogao Grotto and he devotes all his enthusiam to the study of protection of the historic treasure of the world - Dunhuang Frescoes. He is the ruler of us for the reasons that he is not only a professional expert of our topic but also an intelligent guide of all team.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Prof. Jinbo Yang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Jinbo Yang, Doctor of philosophy graduated in Shanghai Research Institute of Biochemistry is also a member of Cuiying Scholar. He once worked as Postdoctoral Research Fellow, Research Associate Staff, Adjunct Staff and finally became a Consultant Staff in Lerner Research Institute, The Cleveland Clinic Foundation since 2001. He is an expert of tumor treatment and synthetic biology, and in 2013 he was the adviser of LZU-China in iGEM contest.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8e/Yangjinbo.jpg" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/6/64/Lixiangkai.jpg" alt="" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Xiangkai Li</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Prof. Xiangka Li, PhD of microbiology in the University of Oklahoma, is also a member of Cuiying Scholar. He worked as a postdoctor fellow in Baylor College of Medicine in America when finishing his PhD. And after that, he has been a professor in microbiology and doctoral advisor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Yongxing He</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Prof. Yongxing He, bachelor of life science and doctor of molecular and biochemistry in University of Science and Technology of China, went to university of California ,Berkeley in 2011 for his postdoctor fellow in biophysics. When finishing postdoctor, he has been a professor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/c/c3/Heyongxing.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv10"><br />
<table width="100%" border="0"><br />
<tr><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ADVISERS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td height="1096"><table width="100%" border="0"><br />
<tr><br />
<td width="20%" height="1476"><p>&nbsp;</p></td><br />
<td width="67%"><table width="100%" border="0"><br />
<tr><br />
<td width="30%"><img src="https://static.igem.org/mediawiki/2014/6/62/Chenzhengjun.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Zhengjun Chen</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Zhengjun Chen (1985- ), male, is studying at Lanzhou University and pursuing a doctor's degree in microbiology. His main research interests are environmental microorganisms, and two papers have been published in SCI. He is also an adviser of iGEM team of Lanzhou University.</span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Rong Xu</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span>Rong Xu , born in July 1987, is a doctor candidate studying in Lanzhou University. She is an expert of heavy metal reduction and cellulose degradation using gene modified bacteria and she does enjoy her researches. Moreover, she helps us with her enthusiasm overcome many kinds of problems about our project. So we believe that she is one of the best advisors in our team-LZU CHINA to attend this competition.</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/7/7a/Xurong.jpg" alt="" width="230" height="306" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/8/8b/Huanghaiying.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Haiying Huang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haiying Huang (1989- ), male, master, main research aspect: The degradation of polycyclic aromatic hydrocarbons and the reducing of the hexavalent chromium by native microorganism . He has published an research paper . He has acquired merit student and scholarship several times during semesters. He was known as a cheerful personality around the laboratory .Currently, he serves as School graduate student Union Vice President . He also acts as advisers in iGEM team of Lanzhou University.</span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Han Wang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span></span>Han Wang, was the team leader of LZU-China 2013, and she was a skillful experimenter and an excellent paper reader. Now, as the chief advisor of LZU-China 2014, she is our most powerful guide.</p><br />
<p></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/1/17/2wanghan.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/c/c0/2lixiaomeng.jpg" alt="" width="230" height="307" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Xiaomeng Li</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiaomeng Li, was the primary contact and planner of LZU-China 2013, and he was a skillful wiki manager and an experienced Image processing manager. Now, as the second chief advisor of LZU-China 2014, he can always give us lots of amazing ideas. </span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Yaxin Pei</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is currently a senior from Tianjin Normal University.&nbsp;And She'll continue her study in Lanzhou University. Doing her graduation design here gives her chance to be a advisor in our team. She may look like a quiet girl, but actually She is an adventurous person and so she loves doing challenging projects. Besides, She also likes exchanging ideas and thoughts with others, especially the knowledgeable people. .</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8a/Peiyaxin.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td height="24"><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/9/91/Studentms.png" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/e/e0/Attribution.png" alt="" width="388" height="90" /></a></td><br />
</tr><br />
</table><br />
<h5>&nbsp;</h5><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Team
Team:LZU-China/Team
2014-10-18T00:50:30Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
background-image: url();<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5888px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:5777px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: left;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our second year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instructions and advices, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><br />
<tr><br />
<td height="550" valign="top" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;STUDENT MEMBERS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="20%" height="4460" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p></td><br />
<td width="67%"><table width="100%" border="0" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><br />
<tr><br />
<td width="30%" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p><img src="https://static.igem.org/mediawiki/2014/4/40/Wuqi.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td width="76%" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">QI WU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is a senior student who loves life and takes great delight in scientific research. For one thing, she likes reading, swimming and playing badminton. She always spends her vacations in having journeys with her friends. For another, as a reliable people who have admirable learning and communication skills, she spares no effort to do her science research during working days. </p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">XIAO ZHANG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiao Zhang majoring in biological science is from Tianjin. As one of the most outstanding student leaders of Lanzhou University, he has many kinds of skills. He is really keen on science research, especially interested in functional genomics, microbiology, and bioinformatics. In our team, as the chief information officer, he developed the monitor program and build the automatic monitor system. In addition, he is also in charge of our wiki editing.</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/9/9b/Zhangxiao.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="307"><p><img src="https://static.igem.org/mediawiki/2014/0/03/Duxuejing.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">XUEJING DU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xuejing Du is one of the student leader of group members in our project. His interest is microbiology and behavioural sciences. It is he who has recruited the key members of this team and has brought a new concept to MFCs. He not only wrote over the 80% of the paperwork but also has done 90% of the artwork for wiki, poster and uniform. Human practice, which we thought a tough, sophisticated burden, was carried by him. In addition, he has designed a questionnaire and made a survey about people's attitude towards sewage treatment and the use of microbial fuel cells in China and UK.His creative ideas help us vastly. Now, he is preparing for the presentation in order to help our team to attend Giant Jamboree in October.</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">HONGXIA ZHAO</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She's a optimistic and outgoing girl always with her shining smile. As a graduating Lanzhou university student,she follows her motto&quot;Action works more efficient than words&quot;and devotes all her passion in every day.She doesn't have a graceful look as Venus but a strong will do live a great life.</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/e/ef/Zhaohuixia.JPG" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/e/e4/Songliyang.jpg" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Liyang Song</td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Liyang Song said that its a great thing to devote his whole life to lifescience. to figure out why our world is so colorful is the most interesting thing to him. he said that,life is a struggle, im not the only one ,lifescience is a tangle, Im not the only one, but I'm the most proactive one. <br />
</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="307"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="32" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">REN YI<br /></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is a senior undergraduate student in Lanzhou University. She was first drawn to iGEM because of its idea of systemic engineering of biology. Studying biology for almost for years make her realize the real practical power of biology lies in synthetic and systems biology, and bioengineering. As an advisor of the 2014 iGEM team of Lanzhou University, She is also going to be one of the presenters of our Microbial Fuel Cells in 2014 iGEM jamboree in Boston.</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span></p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/a/a2/Yiren.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="336"><p><img src="https://static.igem.org/mediawiki/2014/9/9c/Liuwanxiang.jpg" alt="" width="230" height="306" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >WANXIANG LIU</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"></span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Wanxiang Liu,grew up in Xi'an,an ancient capital of China, is a senior biological science base class in Lanzhou University. He devotes himself to learn and explore life science,and always pays attention to the forefront of scientific and technological developments.he has the extraordinary image processing skills and the ability of reading scientech documentation and also brought several important ideas for the team.In addition,he takes charge for assisting other dry experiment group members in some related work in this team, simultaneously participated some wet experiment group's working, so that it can provide a deeper view about the entire project. </p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">YATING WANG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Yating Wang is a third year student in LZU studying Biology. She is taking much more interest in synthetic biology and biochemistry. Enriching knowledge and the debate of new ideas make her excited.That was why she joined the iGEM team to go beyond herself.</p><br />
<p><br /><br />
</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/e/e9/Wangyating.jpg" alt="" width="230" height="306" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/6/6b/Zhongbiyao.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"> BIYAO ZHONG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Biyao Zhong is a sophomore majoring in biology in Lanzhou University currently.She has a great enthusiasm for her major and be strong-willed in doing experiment,also in her part of work and always wants to know why a thing happens like this.She know how to keep E.coli and shewanella and likes to read some book about science. She now enjoys the experience of synthetic biology, at the same time hopes could learn more from others.She likes violin and painting,and walking around to find plants and birds.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">HAOTIAN WANG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haotian Wang is a year 2 student majoring in Bioscience. He is a fan of Liverpool F. C. Being a good striker used to be his dream while he is now a sideback. He is so interested in synthetic biology that he always reads some articles before watching games. His favorite lab is in a basement and he can play with some humor seniors there. </span></p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/9/96/Wanghaotian.jpg" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/3/35/DSC0033.JPG" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">RUIXUE ZHAO</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Ruixue Zhao, a student of Lanzhou University Cuiying honors College. She has gone to the university of Adelaide in South Australia for communication and study in the summer of 2013. And she also has studied how to feed the rats in lab in the autumn of 2013, besides, she went to the lab of biochemistry to learn how to do some biosynthesis. In free time, she likes playing badminton, running, and climbing mountains.</p><br />
<p></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">SHENGCANG ZHU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Shengcang Zhu, undergraduate student of biology in Lanzhou University, is one of the most outstanding students in our college currently who have just acquired "National Endeavor Fellowship" twice( only 3% of the top students can acquire this fellowship). She is one of the iGEM-LZU members in 2014 because of her excellent skills in her major. In addition, her optimistic attitudes towards lives also encourage the group members vastly. There is no doubt that she is a fundamental member of us. </p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/9/95/Zhushengcang.png" alt="" width="230" height="306" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/0/0d/Xuxiaofeng.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">XIAOFENG XU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiaofeng Xu, undergraduate student of Computer Science in Lanzhou University, is a sophomore currently. She is interested in math and biology. Data mining on EEG data and the nuclear magnetic resonance data is her favorite research topic. Unraveling the mysteries of the brain by using computer to cure the mental illness, like epilepsia, is her dream. She is preparing to go abroad to continue her study on the human brain, which are likely to be a really huge field in science soon. She is new in the research world but extremely motivated to learn and to succeed. Her motto is: Go to practice and you'll never regred.</p><br />
<p></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/c/c2/Ianda.png" width="388" height="90" /></a></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/File:Lzumfctt2.jpg
File:Lzumfctt2.jpg
2014-10-17T23:29:38Z
<p>Lzuzx: uploaded a new version of &quot;File:Lzumfctt2.jpg&quot;</p>
<hr />
<div></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/acknowledgement
Team:LZU-China/acknowledgement
2014-10-17T22:14:09Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: left;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
line-height: 32px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2988px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2877px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 16px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2245px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ACKNOWLEDGEMENTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1386"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="70%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;This project is supported by School of Life Science and Cuiying Honors College, Lanzhou University, MOST international cooperation funds, 2014DFA91340, Gansu provincial international cooperation funds, 1304WCGA176, Majorbio Cooperation and Takara China.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><a href="http://en.lzu.edu.cn/"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" alt="" width="220" height="221" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Lanzhou University</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Lanzhou University has been the best university in the northwestern region of China, ranking as one of the top 30 among over 1,500 universities across China. It is one of the key universities administered directly by the Ministry of Education.</span></p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://en.lzu.edu.cn/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="336"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >School of Life Sciences</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The School of Life Sciences at Lanzhou University has a long history. It originated as the Department of Botany and the Department of Zoology of National Lanzhou University, which were founded in 1946 as the first departments of life sciences in western China. After several generations' efforts in over sixty years, the School of Life Science is in a good development trend in many aspects, such as faculty and staff, discipline construction, teaching and researching, and local service. Basing its scientific research on the cold and arid environment in western China, the faculty has made great achievements. The School of Life Sciences is active in international collaboration in order to create an open and supportive academic atmosphere, extend academic horizons, and improve the faculty and students' ability in research and creativity.</span></p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://lifesc.lzu.edu.cn:81/en/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><a href="http://lifesc.lzu.edu.cn:81/en/"><img src="https://static.igem.org/mediawiki/2014/e/e1/LifenewsLogo.png" alt="" width="223" height="220" /></a></p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="306"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Cuiying Honors College</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Cuiying Honors College (CHC) was founded in August 2010 within Lanzhou University as part of China's Top-Notch Undergraduate Training Program. The Ministry of Education and the Ministry of Finance are investing in this new pilot scheme in order to develop future leaders with exceptional talent in the core disciplines. Every year this program only admits the best 1000 students from the 6 million new undergraduates nationwide. Lanzhou University has been selected as one of 19 institutions implementing this national program.</span></p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://chc.lzu.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><a href="http://chc.lzu.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2014/d/d3/Cuiying_honor_college.png" alt="" width="220" height="220" /></a></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><a href="http://www.takara.com.cn/"><img src="https://static.igem.org/mediawiki/2014/8/83/TaKaRalogo.png" alt="" width="283" height="53" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Takara Dalian</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian), located in Dalian Economic and Technical Development Zone, is a subsidiary of Takara Bio Inc.(TBI), the leading Japanese manufacturer of reagents for use in genetic engineering research. Takara Bio Inc.&rsquo;s products are much in demand around the world.&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://www.takara.com.cn/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="http://www.majorbio.com/"><img src="https://static.igem.org/mediawiki/2014/c/c0/Majorbio.png" alt="" width="180" height="65" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Majorbio</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Majorbio(Shanghai) Co., Ltd. is a company focusing on the high-throughput sequencing technology, bioinformatics analysis, and clinical diagnostic kits development. So far Majorbio has build three experiment bases in Shanghai, Beijing and Guangzhou.</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://www.majorbio.com/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Attributionb.png" alt="" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Attribution
Team:LZU-China/Attribution
2014-10-17T22:13:37Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2588px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:2477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 16px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2245px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="261" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ATTRIBUTION</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="180"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="70%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to make sure our work can be carried out more efficiently, the members of our whole team are divided into three Groups, Wet Lab Group A,Wet Lab Group B group and Dry Lab Group. Each group has different missions. Wet Lab Group A's work is constructing new parts and synthetic bacteria. Group B's work is designing and running the MFC devices. Dry Lab Group's work is building the automatic monitor system ,building team cultural and team publicity.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/e/e9/Wla.png" alt="" width="325" height="325" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Wet Lab Group A</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Wet lab group A is </span><span lang="EN-US" xml:lang="EN-US"> actually one part of our team whose duties are parts and synthetic bacteria constructions. What's more they are also in charge of our interlab.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Qi Wu(*) , Haotian Wang , Ruixue Zhao , Shengcang Zhu</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiangkai Li</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Advisers:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rong Xu , Haiying Huang</p><br />
<p>&nbsp;</p><br />
<p>* Qi Wu is the leader of the wet lab gruop A.</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="336"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Wet Lab Group B</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Wet lab group B 's responsibilities are to </span>design MFC device , run it<span lang="EN-US" xml:lang="EN-US"> and give the </span>data which can tell the relationship between the contaminants concentrations and and the MFC output voltage.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Liyang Song(*) , Biyao Zhong , Hongxia Zhao , Yating Wang </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp; Xiangkai Li</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Advisers:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Zhengjun Chen , Yaxin Pei </p><br />
<p>&nbsp;</p><br />
<p>* Liyang Song is the leader of the wet lab group B.</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/f/f3/Wlb.png" alt="" width="310" height="310" /></p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="33%"><img src="https://static.igem.org/mediawiki/2014/1/13/Rlg.png" alt="" width="317" height="318" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Dry Lab Group</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Dry lab group </span>is in charge of all kinds of work outside the wet lab. In most cases, they are engaged in dealing with following responsibilities, such as programing , building the automatic monitor system, preparing scientific reports, building team cultural team publicity and huam practice.</p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Xuejing Du(*) , Xiao Zhang(**) , Wanxiang Liu , Xiaofeng Xu</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Yongxing He</p><br />
<p>&nbsp; </p><br />
<p>* Xuejing Du is our human practice manager. He designed our questionnaires. What's more he drew all the wiki materials and designed our posters.</p><br />
<p>** Xiao Zhang is our chief information officer. He developed the monitor program, and build the automatic monitor system. In addition, he is also in charge of our wiki editing.</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/c/c4/Instructorsb.png" alt="" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/ce/Acknob.png" alt="" width="388" height="90" /></a></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="http://ntu.so/di/HI83E/dibluebar.png" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><a href="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></a></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Instructors
Team:LZU-China/Instructors
2014-10-17T22:12:44Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5088px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:4977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2445px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="261" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INSTRUCTORS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1419"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/9/97/Fenghuyuan.jpg" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Vice dean Prof Huyuan Feng </span></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Huyuan Feng, Doctor of philosophy graduated in Lanzhou University, as the Vice Dean of School of Life Sciences, Lanzhou University, China will lead this team.&nbsp; His present research subject is microbio strains living on Dunhuang Mogao Grotto and he devotes all his enthusiam to the study of protection of the historic treasure of the world - Dunhuang Frescoes. He is the ruler of us for the reasons that he is not only a professional expert of our topic but also an intelligent guide of all team.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Prof. Jinbo Yang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Jinbo Yang, Doctor of philosophy graduated in Shanghai Research Institute of Biochemistry is also a member of Cuiying Scholar. He once worked as Postdoctoral Research Fellow, Research Associate Staff, Adjunct Staff and finally became a Consultant Staff in Lerner Research Institute, The Cleveland Clinic Foundation since 2001. He is an expert of tumor treatment and synthetic biology, and in 2013 he was the adviser of LZU-China in iGEM contest.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8e/Yangjinbo.jpg" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/6/64/Lixiangkai.jpg" alt="" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Xiangkai Li</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Prof. Xiangka Li, PhD of microbiology in the University of Oklahoma, is also a member of Cuiying Scholar. He worked as a postdoctor fellow in Baylor College of Medicine in America when finishing his PhD. And after that, he has been a professor in microbiology and doctoral advisor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Yongxing He</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Prof. Yongxing He, bachelor of life science and doctor of molecular and biochemistry in University of Science and Technology of China, went to university of California ,Berkeley in 2011 for his postdoctor fellow in biophysics. When finishing postdoctor, he has been a professor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/c/c3/Heyongxing.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv10"><br />
<table width="100%" border="0"><br />
<tr><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ADVISERS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td height="1096"><table width="100%" border="0"><br />
<tr><br />
<td width="20%" height="1476"><p>&nbsp;</p></td><br />
<td width="67%"><table width="100%" border="0"><br />
<tr><br />
<td width="30%"><img src="https://static.igem.org/mediawiki/2014/6/62/Chenzhengjun.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Zhengjun Chen</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Zhengjun Chen (1985- ), male, is studying at Lanzhou University and pursuing a doctor's degree in microbiology. His main research interests are environmental microorganisms, and two papers have been published in SCI. He is also an adviser of iGEM team of Lanzhou University.</span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Rong Xu</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span>Rong Xu , born in July 1987, is a doctor candidate studying in Lanzhou University. She is an expert of heavy metal reduction and cellulose degradation using gene modified bacteria and she does enjoy her researches. Moreover, she helps us with her enthusiasm overcome many kinds of problems about our project. So we believe that she is one of the best advisors in our team-LZU CHINA to attend this competition.</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/7/7a/Xurong.jpg" alt="" width="230" height="306" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/8/8b/Huanghaiying.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Haiying Huang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haiying Huang (1989- ), male, master, main research aspect: The degradation of polycyclic aromatic hydrocarbons and the reducing of the hexavalent chromium by native microorganism . He has published an research paper . He has acquired merit student and scholarship several times during semesters. He was known as a cheerful personality around the laboratory .Currently, he serves as School graduate student Union Vice President . He also acts as advisers in iGEM team of Lanzhou University.</span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Han Wang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span></span>Han Wang, was the team leader of LZU-China 2013, and she was a skillful experimenter and an excellent paper reader. Now, as the chief advisor of LZU-China 2014, she is our most powerful guide.</p><br />
<p></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/1/17/2wanghan.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/c/c0/2lixiaomeng.jpg" alt="" width="230" height="307" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Xiaomeng Li</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiaomeng Li, was the primary contact and planner of LZU-China 2013, and he was a skillful wiki manager and an experienced Image processing manager. Now, as the second chief advisor of LZU-China 2014, he can always give us lots of amazing ideas. </span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Yaxin Pei</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is currently a senior from Tianjin Normal University.&nbsp;And She'll continue her study in Lanzhou University. Doing her graduation design here gives her chance to be a advisor in our team. She may look like a quiet girl, but actually She is an adventurous person and so she loves doing challenging projects. Besides, She also likes exchanging ideas and thoughts with others, especially the knowledgeable people. .</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8a/Peiyaxin.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td height="24"><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/9/91/Studentms.png" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/e/e0/Attribution.png" alt="" width="388" height="90" /></a></td><br />
</tr><br />
</table><br />
<h5>&nbsp;</h5><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Team
Team:LZU-China/Team
2014-10-17T22:12:09Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
background-image: url();<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5888px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:5777px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: left;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="261" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our second year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 6 advisers in our team. With their instructions and advices, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><br />
<tr><br />
<td height="550" valign="top" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;STUDENT MEMBERS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="20%" height="4460" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p></td><br />
<td width="67%"><table width="100%" border="0" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><br />
<tr><br />
<td width="30%" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p><img src="https://static.igem.org/mediawiki/2014/4/40/Wuqi.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td width="76%" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">QI WU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is a senior student who loves life and takes great delight in scientific research. For one thing, she likes reading, swimming and playing badminton. She always spends her vacations in having journeys with her friends. For another, as a reliable people who have admirable learning and communication skills, she spares no effort to do her science research during working days. </p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">XIAO ZHANG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiao Zhang majoring in biological science is from Tianjin. As one of the most outstanding student leaders of Lanzhou University, he has many kinds of skills. He is really keen on science research, especially interested in functional genomics, microbiology, and bioinformatics. In our team, as the chief information officer, he developed the monitor program and build the automatic monitor system. In addition, he is also in charge of our wiki editing.</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/9/9b/Zhangxiao.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="307"><p><img src="https://static.igem.org/mediawiki/2014/0/03/Duxuejing.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">XUEJING DU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xuejing Du is one of the student leader of group members in our project. His interest is microbiology and behavioural sciences. It is he who has recruited the key members of this team and has brought a new concept to MFCs. He not only wrote over the 80% of the paperwork but also has done 90% of the artwork for wiki, poster and uniform. Human practice, which we thought a tough, sophisticated burden, was carried by him. In addition, he has designed a questionnaire and made a survey about people's attitude towards sewage treatment and the use of microbial fuel cells in China and UK.His creative ideas help us vastly. Now, he is preparing for the presentation in order to help our team to attend Giant Jamboree in October.</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">HONGXIA ZHAO</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She's a optimistic and outgoing girl always with her shining smile. As a graduating Lanzhou university student,she follows her motto&quot;Action works more efficient than words&quot;and devotes all her passion in every day.She doesn't have a graceful look as Venus but a strong will do live a great life.</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/e/ef/Zhaohuixia.JPG" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/e/e4/Songliyang.jpg" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Liyang Song</td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Liyang Song said that its a great thing to devote his whole life to lifescience. to figure out why our world is so colorful is the most interesting thing to him. he said that,life is a struggle, im not the only one ,lifescience is a tangle, Im not the only one, but I'm the most proactive one. <br />
</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="307"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td height="32" background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">REN YI<br /></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is a senior undergraduate student in Lanzhou University. She was first drawn to iGEM because of its idea of systemic engineering of biology. Studying biology for almost for years make her realize the real practical power of biology lies in synthetic and systems biology, and bioengineering. As an advisor of the 2014 iGEM team of Lanzhou University, She is also going to be one of the presenters of our Microbial Fuel Cells in 2014 iGEM jamboree in Boston.</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span></p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/a/a2/Yiren.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="336"><p><img src="https://static.igem.org/mediawiki/2014/9/9c/Liuwanxiang.jpg" alt="" width="230" height="306" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >WANXIANG LIU</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"></span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Wanxiang Liu,grew up in Xi'an,an ancient capital of China, is a senior biological science base class in Lanzhou University. He devotes himself to learn and explore life science,and always pays attention to the forefront of scientific and technological developments.he has the extraordinary image processing skills and the ability of reading scientech documentation and also brought several important ideas for the team.In addition,he takes charge for assisting other dry experiment group members in some related work in this team, simultaneously participated some wet experiment group's working, so that it can provide a deeper view about the entire project. </p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">YATING WANG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Yating Wang is a third year student in LZU studying Biology. She is taking much more interest in synthetic biology and biochemistry. Enriching knowledge and the debate of new ideas make her excited.That was why she joined the iGEM team to go beyond herself.</p><br />
<p><br /><br />
</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/e/e9/Wangyating.jpg" alt="" width="230" height="306" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/6/6b/Zhongbiyao.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"> BIYAO ZHONG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Biyao Zhong is a sophomore majoring in biology in Lanzhou University currently.She has a great enthusiasm for her major and be strong-willed in doing experiment,also in her part of work and always wants to know why a thing happens like this.She know how to keep E.coli and shewanella and likes to read some book about science. She now enjoys the experience of synthetic biology, at the same time hopes could learn more from others.She likes violin and painting,and walking around to find plants and birds.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">HAOTIAN WANG</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haotian Wang is a year 2 student majoring in Bioscience. He is a fan of Liverpool F. C. Being a good striker used to be his dream while he is now a sideback. He is so interested in synthetic biology that he always reads some articles before watching games. His favorite lab is in a basement and he can play with some humor seniors there. </span></p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/9/96/Wanghaotian.jpg" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/3/35/DSC0033.JPG" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">RUIXUE ZHAO</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Ruixue Zhao, a student of Lanzhou University Cuiying honors College. She has gone to the university of Adelaide in South Australia for communication and study in the summer of 2013. And she also has studied how to feed the rats in lab in the autumn of 2013, besides, she went to the lab of biochemistry to learn how to do some biosynthesis. In free time, she likes playing badminton, running, and climbing mountains.</p><br />
<p></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">SHENGCANG ZHU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Shengcang Zhu, undergraduate student of biology in Lanzhou University, is one of the most outstanding students in our college currently who have just acquired "National Endeavor Fellowship" twice( only 3% of the top students can acquire this fellowship). She is one of the iGEM-LZU members in 2014 because of her excellent skills in her major. In addition, her optimistic attitudes towards lives also encourage the group members vastly. There is no doubt that she is a fundamental member of us. </p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/9/95/Zhushengcang.png" alt="" width="230" height="306" /></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><p><img src="https://static.igem.org/mediawiki/2014/0/0d/Xuxiaofeng.jpg" alt="" width="230" height="307" /></p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">XIAOFENG XU</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiaofeng Xu, undergraduate student of Computer Science in Lanzhou University, is a sophomore currently. She is interested in math and biology. Data mining on EEG data and the nuclear magnetic resonance data is her favorite research topic. Unraveling the mysteries of the brain by using computer to cure the mental illness, like epilepsia, is her dream. She is preparing to go abroad to continue her study on the human brain, which are likely to be a really huge field in science soon. She is new in the research world but extremely motivated to learn and to succeed. Her motto is: Go to practice and you'll never regred.</p><br />
<p></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/c/c2/Ianda.png" width="388" height="90" /></a></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/acknowledgement
Team:LZU-China/acknowledgement
2014-10-17T21:44:24Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: left;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
line-height: 32px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2988px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2877px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 16px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2245px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 4 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ACKNOWLEDGEMENTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1386"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="70%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;This project is supported by School of Life Science and Cuiying Honors College, Lanzhou University, MOST international cooperation funds, 2014DFA91340, Gansu provincial international cooperation funds, 1304WCGA176, Majorbio Cooperation and Takara China.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><a href="http://en.lzu.edu.cn/"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" alt="" width="220" height="221" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Lanzhou University</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Lanzhou University has been the best university in the northwestern region of China, ranking as one of the top 30 among over 1,500 universities across China. It is one of the key universities administered directly by the Ministry of Education.</span></p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://en.lzu.edu.cn/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="336"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >School of Life Sciences</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The School of Life Sciences at Lanzhou University has a long history. It originated as the Department of Botany and the Department of Zoology of National Lanzhou University, which were founded in 1946 as the first departments of life sciences in western China. After several generations' efforts in over sixty years, the School of Life Science is in a good development trend in many aspects, such as faculty and staff, discipline construction, teaching and researching, and local service. Basing its scientific research on the cold and arid environment in western China, the faculty has made great achievements. The School of Life Sciences is active in international collaboration in order to create an open and supportive academic atmosphere, extend academic horizons, and improve the faculty and students' ability in research and creativity.</span></p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://lifesc.lzu.edu.cn:81/en/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><a href="http://lifesc.lzu.edu.cn:81/en/"><img src="https://static.igem.org/mediawiki/2014/e/e1/LifenewsLogo.png" alt="" width="223" height="220" /></a></p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="306"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Cuiying Honors College</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Cuiying Honors College (CHC) was founded in August 2010 within Lanzhou University as part of China's Top-Notch Undergraduate Training Program. The Ministry of Education and the Ministry of Finance are investing in this new pilot scheme in order to develop future leaders with exceptional talent in the core disciplines. Every year this program only admits the best 1000 students from the 6 million new undergraduates nationwide. Lanzhou University has been selected as one of 19 institutions implementing this national program.</span></p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://chc.lzu.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><a href="http://chc.lzu.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2014/d/d3/Cuiying_honor_college.png" alt="" width="220" height="220" /></a></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><a href="http://www.takara.com.cn/"><img src="https://static.igem.org/mediawiki/2014/8/83/TaKaRalogo.png" alt="" width="283" height="53" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Takara Dalian</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian), located in Dalian Economic and Technical Development Zone, is a subsidiary of Takara Bio Inc.(TBI), the leading Japanese manufacturer of reagents for use in genetic engineering research. Takara Bio Inc.&rsquo;s products are much in demand around the world.&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://www.takara.com.cn/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="http://www.majorbio.com/"><img src="https://static.igem.org/mediawiki/2014/c/c0/Majorbio.png" alt="" width="180" height="65" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Majorbio</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Majorbio(Shanghai) Co., Ltd. is a company focusing on the high-throughput sequencing technology, bioinformatics analysis, and clinical diagnostic kits development. So far Majorbio has build three experiment bases in Shanghai, Beijing and Guangzhou.</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://www.majorbio.com/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Attributionb.png" alt="" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/acknowledgement
Team:LZU-China/acknowledgement
2014-10-17T21:43:53Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: left;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
line-height: 32px;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2988px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2877px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 16px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2245px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 4 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ACKNOWLEDGEMENTS</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1386"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="70%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;This project is supported by School of Life Science and Cuiying Honors College, Lanzhou University, MOST international cooperation funds, 2014DFA91340, Gansu provincial international cooperation funds, 1304WCGA176, Majorbio Cooperation and Takara China.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><a href="http://en.lzu.edu.cn/"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" alt="" width="220" height="221" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Lanzhou University</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Lanzhou University has been the best university in the northwestern region of China, ranking as one of the top 30 among over 1,500 universities across China. It is one of the key universities administered directly by the Ministry of Education.</span></p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://en.lzu.edu.cn/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="336"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >School of Life Sciences</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The School of Life Sciences at Lanzhou University has a long history. It originated as the Department of Botany and the Department of Zoology of National Lanzhou University, which were founded in 1946 as the first departments of life sciences in western China. After several generations' efforts in over sixty years, the School of Life Science is in a good development trend in many aspects, such as faculty and staff, discipline construction, teaching and researching, and local service. Basing its scientific research on the cold and arid environment in western China, the faculty has made great achievements. The School of Life Sciences is active in international collaboration in order to create an open and supportive academic atmosphere, extend academic horizons, and improve the faculty and students' ability in research and creativity.</span></p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://lifesc.lzu.edu.cn:81/en/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><a href="http://lifesc.lzu.edu.cn:81/en/"><img src="https://static.igem.org/mediawiki/2014/e/e1/LifenewsLogo.png" alt="" width="223" height="220" /></a></p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="306"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Cuiying Honors College</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Cuiying Honors College (CHC) was founded in August 2010 within Lanzhou University as part of China's Top-Notch Undergraduate Training Program. The Ministry of Education and the Ministry of Finance are investing in this new pilot scheme in order to develop future leaders with exceptional talent in the core disciplines. Every year this program only admits the best 1000 students from the 6 million new undergraduates nationwide. Lanzhou University has been selected as one of 19 institutions implementing this national program.</span></p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://chc.lzu.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><a href="http://chc.lzu.edu.cn/en/"><img src="https://static.igem.org/mediawiki/2014/d/d3/Cuiying_honor_college.png" alt="" width="220" height="220" /></a></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><a href="http://www.takara.com.cn/"><img src="https://static.igem.org/mediawiki/2014/8/83/TaKaRalogo.png" alt="" width="283" height="53" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Takara Dalian</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Takara Biotechnology (Dalian) Co., Ltd. (Takara Dalian), located in Dalian Economic and Technical Development Zone, is a subsidiary of Takara Bio Inc.(TBI), the leading Japanese manufacturer of reagents for use in genetic engineering research. Takara Bio Inc.&rsquo;s products are much in demand around the world.&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://www.takara.com.cn/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="http://www.majorbio.com/"><img src="https://static.igem.org/mediawiki/2014/c/c0/Majorbio.png" alt="" width="180" height="65" /></a></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Majorbio</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Majorbio(Shanghai) Co., Ltd. is a company focusing on the high-throughput sequencing technology, bioinformatics analysis, and clinical diagnostic kits development. So far Majorbio has build three experiment bases in Shanghai, Beijing and Guangzhou.</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="65%" height="50">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><a href="http://www.majorbio.com/"><img src="https://static.igem.org/mediawiki/2014/7/70/More.png" alt="" width="172" height="40" /></a></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Attributionb.png" alt="" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Attribution
Team:LZU-China/Attribution
2014-10-17T21:36:58Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2588px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:2477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 16px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2245px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="261" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 4 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ATTRIBUTION</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="180"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="70%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In order to make sure our work can be carried out more efficiently, the members of our whole team are divided into three Groups, Wet Lab Group A,Wet Lab Group B group and Dry Lab Group. Each group has different missions. Wet Lab Group A's work is constructing new parts and synthetic bacteria. Group B's work is designing and running the MFC devices. Dry Lab Group's work is building the automatic monitor system ,building team cultural and team publicity.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/e/e9/Wla.png" alt="" width="325" height="325" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Wet Lab Group A</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Wet lab group A is </span><span lang="EN-US" xml:lang="EN-US"> actually one part of our team whose duties are parts and synthetic bacteria constructions. What's more they are also in charge of our interlab.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Qi Wu(*) , Haotian Wang , Ruixue Zhao , Shengcang Zhu</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiangkai Li</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Advisers:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Rong Xu , Haiying Huang</p><br />
<p>&nbsp;</p><br />
<p>* Qi Wu is the leader of the wet lab gruop A.</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="80%" height="336"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Wet Lab Group B</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Wet lab group B 's responsibilities are to </span>design MFC device , run it<span lang="EN-US" xml:lang="EN-US"> and give the </span>data which can tell the relationship between the contaminants concentrations and and the MFC output voltage.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Liyang Song(*) , Biyao Zhong , Hongxia Zhao , Yating Wang </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp; Xiangkai Li</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Advisers:&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Zhengjun Chen , Yaxin Pei </p><br />
<p>&nbsp;</p><br />
<p>* Liyang Song is the leader of the wet lab group B.</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/f/f3/Wlb.png" alt="" width="310" height="310" /></p></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="33%"><img src="https://static.igem.org/mediawiki/2014/1/13/Rlg.png" alt="" width="317" height="318" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">Dry Lab Group</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Dry lab group </span>is in charge of all kinds of work outside the wet lab. In most cases, they are engaged in dealing with following responsibilities, such as programing , building the automatic monitor system, preparing scientific reports, building team cultural team publicity and huam practice.</p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Studnet members: &nbsp;&nbsp;&nbsp;&nbsp;Xuejing Du(*) , Xiao Zhang(**) , Wanxiang Liu , Xiaofeng Xu</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Instructor: &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Yongxing He</p><br />
<p>&nbsp; </p><br />
<p>* Xuejing Du is our human practice manager. He designed our questionnaires. What's more he drew all the wiki materials and designed our posters.</p><br />
<p>** Xiao Zhang is our chief information officer. He developed the monitor program, and build the automatic monitor system. In addition, he is also in charge of our wiki editing.</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/c/c4/Instructorsb.png" alt="" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/ce/Acknob.png" alt="" width="388" height="90" /></a></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="http://ntu.so/di/HI83E/dibluebar.png" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><a href="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></a></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Instructors
Team:LZU-China/Instructors
2014-10-17T21:32:10Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5088px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:4977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2445px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="261" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 4 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INSTRUCTORS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1419"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/9/97/Fenghuyuan.jpg" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Vice dean Prof Huyuan Feng </span></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Huyuan Feng, Doctor of philosophy graduated in Lanzhou University, as the Vice Dean of School of Life Sciences, Lanzhou University, China will lead this team.&nbsp; His present research subject is microbio strains living on Dunhuang Mogao Grotto and he devotes all his enthusiam to the study of protection of the historic treasure of the world - Dunhuang Frescoes. He is the ruler of us for the reasons that he is not only a professional expert of our topic but also an intelligent guide of all team.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Prof. Jinbo Yang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Jinbo Yang, Doctor of philosophy graduated in Shanghai Research Institute of Biochemistry is also a member of Cuiying Scholar. He once worked as Postdoctoral Research Fellow, Research Associate Staff, Adjunct Staff and finally became a Consultant Staff in Lerner Research Institute, The Cleveland Clinic Foundation since 2001. He is an expert of tumor treatment and synthetic biology, and in 2013 he was the adviser of LZU-China in iGEM contest.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8e/Yangjinbo.jpg" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/6/64/Lixiangkai.jpg" alt="" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Xiangkai Li</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Prof. Xiangka Li, PhD of microbiology in the University of Oklahoma, is also a member of Cuiying Scholar. He worked as a postdoctor fellow in Baylor College of Medicine in America when finishing his PhD. And after that, he has been a professor in microbiology and doctoral advisor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Yongxing He</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Prof. Yongxing He, bachelor of life science and doctor of molecular and biochemistry in University of Science and Technology of China, went to university of California ,Berkeley in 2011 for his postdoctor fellow in biophysics. When finishing postdoctor, he has been a professor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/c/c3/Heyongxing.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv10"><br />
<table width="100%" border="0"><br />
<tr><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ADVISERS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td height="1096"><table width="100%" border="0"><br />
<tr><br />
<td width="20%" height="1476"><p>&nbsp;</p></td><br />
<td width="67%"><table width="100%" border="0"><br />
<tr><br />
<td width="30%"><img src="https://static.igem.org/mediawiki/2014/6/62/Chenzhengjun.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Zhengjun Chen</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Zhengjun Chen (1985- ), male, is studying at Lanzhou University and pursuing a doctor's degree in microbiology. His main research interests are environmental microorganisms, and two papers have been published in SCI. He is also an adviser of iGEM team of Lanzhou University.</span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Rong Xu</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span>Rong Xu , born in July 1987, is a doctor candidate studying in Lanzhou University. She is an expert of heavy metal reduction and cellulose degradation using gene modified bacteria and she does enjoy her researches. Moreover, she helps us with her enthusiasm overcome many kinds of problems about our project. So we believe that she is one of the best advisors in our team-LZU CHINA to attend this competition.</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/7/7a/Xurong.jpg" alt="" width="230" height="306" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/8/8b/Huanghaiying.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Haiying Huang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haiying Huang (1989- ), male, master, main research aspect: The degradation of polycyclic aromatic hydrocarbons and the reducing of the hexavalent chromium by native microorganism . He has published an research paper . He has acquired merit student and scholarship several times during semesters. He was known as a cheerful personality around the laboratory .Currently, he serves as School graduate student Union Vice President . He also acts as advisers in iGEM team of Lanzhou University.</span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Han Wang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span></span>Han Wang, was the team leader of LZU-China 2013, and she was a skillful experimenter and an excellent paper reader. Now, as the chief advisor of LZU-China 2014, she is our most powerful guide.</p><br />
<p></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/1/17/2wanghan.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/c/c0/2lixiaomeng.jpg" alt="" width="230" height="307" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Xiaomeng Li</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiaomeng Li, was the primary contact and planner of LZU-China 2013, and he was a skillful wiki manager and an experienced Image processing manager. Now, as the second chief advisor of LZU-China 2014, he can always give us lots of amazing ideas. </span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Yaxin Pei</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is currently a senior from Tianjin Normal University.&nbsp;And She'll continue her study in Lanzhou University. Doing her graduation design here gives her chance to be a advisor in our team. She may look like a quiet girl, but actually She is an adventurous person and so she loves doing challenging projects. Besides, She also likes exchanging ideas and thoughts with others, especially the knowledgeable people. .</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8a/Peiyaxin.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td height="24"><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/9/91/Studentms.png" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/e/e0/Attribution.png" alt="" width="388" height="90" /></a></td><br />
</tr><br />
</table><br />
<h5>&nbsp;</h5><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Instructors
Team:LZU-China/Instructors
2014-10-17T21:30:51Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
text-align: center;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:704px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5088px;<br />
width:100%;<br />
height:24;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:41%;<br />
top:4977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:4831px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 32px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td br {<br />
}<br />
#apDiv4 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td p {<br />
text-align: center;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:2445px;<br />
width:100%;<br />
height:269px;<br />
z-index:0;<br />
}<br />
#apDiv10 table tr td div {<br />
font-size: 45px;<br />
text-align: left;<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td span {<br />
}<br />
#apDiv10 table tr td table tr td table tr td table tr td {<br />
font-size: 30px;<br />
text-align: center;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td table tr td table tr td p span {<br />
font-size: 15px;<br />
line-height: 31px;<br />
}<br />
#apDiv10 table tr td {<br />
text-align: center;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/d/de/6members.top.jpg" width="1366" height="270" /></p></td><br />
<td width="261" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td width="50%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">The LZU-china iGEM 2014 team consists of 13 dedicated undergraduate students forming a large family. This year, it is our seconed year to attend iGEM. There is no doubt that we are all enthusiastic for researches and experiments. All of us have been looking forward to understanding more about life sciences.</span></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;What's more there are also 4 instructors and 4 advisers in our team. With their instruction and advice, We can translate our ideas into reality much easier. </p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p><br />
<!-- ImageReady Slices (logbar.psd) --><br />
<!-- End ImageReady Slices --><br />
</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/8/8d/Z_01.png" alt="" width="228" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Instructors"><img src="https://static.igem.org/mediawiki/2014/e/ee/Z_02.png" alt="" width="213" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/6/6d/Z_03.png" alt="" width="212" height="73" /></a><a href="https://2014.igem.org/Team:LZU-China/acknowledgement"><img src="https://static.igem.org/mediawiki/2014/c/c1/Z_04.png" alt="" width="287" height="73" /></a></div><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0" background="huils.jpg"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INSTRUCTORS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="20%" height="1419"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="67%"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/9/97/Fenghuyuan.jpg" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Vice dean Prof Huyuan Feng </span></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Huyuan Feng, Doctor of philosophy graduated in Lanzhou University, as the Vice Dean of School of Life Sciences, Lanzhou University, China will lead this team.&nbsp; His present research subject is microbio strains living on Dunhuang Mogao Grotto and he devotes all his enthusiam to the study of protection of the historic treasure of the world - Dunhuang Frescoes. He is the ruler of us for the reasons that he is not only a professional expert of our topic but also an intelligent guide of all team.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table> <p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >Prof. Jinbo Yang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Prof. Jinbo Yang, Doctor of philosophy graduated in Shanghai Research Institute of Biochemistry is also a member of Cuiying Scholar. He once worked as Postdoctoral Research Fellow, Research Associate Staff, Adjunct Staff and finally became a Consultant Staff in Lerner Research Institute, The Cleveland Clinic Foundation since 2001. He is an expert of tumor treatment and synthetic biology, and in 2013 he was the adviser of LZU-China in iGEM contest.</span><span lang="EN-US" xml:lang="EN-US"> </span></span></p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8e/Yangjinbo.jpg" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%"><img src="https://static.igem.org/mediawiki/2014/6/64/Lixiangkai.jpg" alt="" width="230" height="307" /></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Xiangkai Li</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US"></span>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Prof. Xiangka Li, PhD of microbiology in the University of Oklahoma, is also a member of Cuiying Scholar. He worked as a postdoctor fellow in Baylor College of Medicine in America when finishing his PhD. And after that, he has been a professor in microbiology and doctoral advisor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="74%" height="312"><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><span lang="EN-US" xml:lang="EN-US">Prof. Yongxing He</span><span lang="EN-US" xml:lang="EN-US"> </span></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span>Prof. Yongxing He, bachelor of life science and doctor of molecular and biochemistry in University of Science and Technology of China, went to university of California ,Berkeley in 2011 for his postdoctor fellow in biophysics. When finishing postdoctor, he has been a professor in Lanzhou University till now.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p></p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="26%"><p><img src="https://static.igem.org/mediawiki/2014/c/c3/Heyongxing.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv10"><br />
<table width="100%" border="0"><br />
<tr><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ADVISERS</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td height="1096"><table width="100%" border="0"><br />
<tr><br />
<td width="20%" height="1476"><p>&nbsp;</p></td><br />
<td width="67%"><table width="100%" border="0"><br />
<tr><br />
<td width="30%"><img src="https://static.igem.org/mediawiki/2014/6/62/Chenzhengjun.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Zhengjun Chen</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">Zhengjun Chen (1985- ), male, is studying at Lanzhou University and pursuing a doctor's degree in microbiology. His main research interests are environmental microorganisms, and two papers have been published in SCI. He is also an adviser of iGEM team of Lanzhou University.</span></span></p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Rong Xu</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span>Rong Xu , born in July 1987, is a doctor candidate studying in Lanzhou University. She is an expert of heavy metal reduction and cellulose degradation using gene modified bacteria and she does enjoy her researches. Moreover, she helps us with her enthusiasm overcome many kinds of problems about our project. So we believe that she is one of the best advisors in our team-LZU CHINA to attend this competition.</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/7/7a/Xurong.jpg" alt="" width="230" height="306" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/8/8b/Huanghaiying.jpg" alt="" width="230" height="306" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Haiying Huang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Haiying Huang (1989- ), male, master, main research aspect: The degradation of polycyclic aromatic hydrocarbons and the reducing of the hexavalent chromium by native microorganism . He has published an research paper . He has acquired merit student and scholarship several times during semesters. He was known as a cheerful personality around the laboratory .Currently, he serves as School graduate student Union Vice President . He also acts as advisers in iGEM team of Lanzhou University.</span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Han Wang</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US"></span></span>Han Wang, was the team leader of LZU-China 2013, and she was a skillful experimenter and an excellent paper reader. Now, as the chief advisor of LZU-China 2014, she is our most powerful guide.</p><br />
<p></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/1/17/2wanghan.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="306"><img src="https://static.igem.org/mediawiki/2014/c/c0/2lixiaomeng.jpg" alt="" width="230" height="307" /></td><br />
<td width="76%"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Xiaomeng Li</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Xiaomeng Li, was the primary contact and planner of LZU-China 2013, and he was a skillful wiki manager and an experienced Image processing manager. Now, as the second chief advisor of LZU-China 2014, he can always give us lots of amazing ideas. </span></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="74%" height="312"><p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td>Yaxin Pei</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;She is currently a senior from Tianjin Normal University.&nbsp;And She'll continue her study in Lanzhou University. Doing her graduation design here gives her chance to be a advisor in our team. She may look like a quiet girl, but actually She is an adventurous person and so she loves doing challenging projects. Besides, She also likes exchanging ideas and thoughts with others, especially the knowledgeable people. .</span></p><br />
<p></p></td><br />
<td width="26%"><p><img src="https://static.igem.org/mediawiki/2014/8/8a/Peiyaxin.jpg" alt="" width="230" height="307" /></p></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td height="24"><span lang="EN-US" xml:lang="EN-US"><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;<a href="https://2014.igem.org/Team:LZU-China/Team"><img src="https://static.igem.org/mediawiki/2014/9/91/Studentms.png" width="388" height="90" /></a>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;</span>&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</span><a href="https://2014.igem.org/Team:LZU-China/Attribution"><img src="https://static.igem.org/mediawiki/2014/e/e0/Attribution.png" alt="" width="388" height="90" /></a></td><br />
</tr><br />
</table><br />
<h5>&nbsp;</h5><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script></p><br />
<p>&nbsp;</p><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgements</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://igem.org/Team.cgi?year=2014&team_name=LZU-China">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T21:12:23Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:7788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:7677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/f/f7/Interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/1e/LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/a/a9/LZUimage005.png" width="520" height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture 1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 are the device 3's. Each picture is 400x and we calculated the light spot. The result are listed here:</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/9/91/LZUIMAGE4.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/3e/Image006.png" alt="" width="569" height="279" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" alt="" width="697" height="123" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/85/Lzuinter_(2).png" alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/56/Lzuinter_(3).png" alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/89/Lzuinter_(1).png" alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who would be an author on any resulting publication. For example, your faculty advisor may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this will often be a range of dates; make sure you say which data was taken at what times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on 2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed successfully on different date. Device 1 took more time, about 7 days and was got on October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your instrument as configured for these measurements? (e.g., a meter stick measures in the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/7/71/LZUIMAGE6.png" alt="" width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" width="697" height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T21:11:03Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:7788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:7677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/f/f7/Interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/1e/LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/a/a9/LZUimage005.png" width="520" height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture 1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 are the device 3's. Each picture is 400x and we calculated the light spot. The result are listed here:</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/9/91/LZUIMAGE4.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/3e/Image006.png" alt="" width="569" height="279" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" alt="" width="697" height="123" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/85/Lzuinter_(2).png" alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/56/Lzuinter_(3).png" alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/89/Lzuinter_(1).png" alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who would be an author on any resulting publication. For example, your faculty advisor may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this will often be a range of dates; make sure you say which data was taken at what times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on 2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed successfully on different date. Device 1 took more time, about 7 days and was got on October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your instrument as configured for these measurements? (e.g., a meter stick measures in the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/7/71/LZUIMAGE6.png" alt="" width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" width="697" height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T21:04:28Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:8788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:8677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/f/f7/Interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/1e/LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/a/a9/LZUimage005.png" width="520" height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture 1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 are the device 3's. Each picture is 400x and we calculated the light spot. The result are listed here:</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/9/91/LZUIMAGE4.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/3e/Image006.png" alt="" width="569" height="279" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" alt="" width="697" height="123" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/85/Lzuinter_(2).png" alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/56/Lzuinter_(3).png" alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/89/Lzuinter_(1).png" alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who would be an author on any resulting publication. For example, your faculty advisor may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this will often be a range of dates; make sure you say which data was taken at what times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on 2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed successfully on different date. Device 1 took more time, about 7 days and was got on October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your instrument as configured for these measurements? (e.g., a meter stick measures in the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/7/71/LZUIMAGE6.png" alt="" width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" width="697" height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T20:55:48Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:9088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:8977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/f/f7/Interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="https://2014.igem.org/File:LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/a/a9/LZUimage005.png" width="520" height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture 1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 are the device 3's. Each picture is 400x and we calculated the light spot. The result are listed here:</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/1e/LZUimage003.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/3e/Image006.png" alt="" width="569" height="279" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" alt="" width="697" height="123" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/85/Lzuinter_(2).png" alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/56/Lzuinter_(3).png" alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/89/Lzuinter_(1).png" alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who would be an author on any resulting publication. For example, your faculty advisor may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this will often be a range of dates; make sure you say which data was taken at what times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on 2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed successfully on different date. Device 1 took more time, about 7 days and was got on October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your instrument as configured for these measurements? (e.g., a meter stick measures in the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/7/71/LZUIMAGE6.png" alt="" width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" width="697" height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T20:53:06Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:9088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:8977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/f/f7/Interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="https://2014.igem.org/File:LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/a/a9/LZUimage005.png" width="520" height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture 1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 are the device 3's. Each picture is 400x and we calculated the light spot. The result are listed here:</p><br />
<div><img src="https://2014.igem.org/File:LZUIMAGE4.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/3e/Image006.png" alt="" width="569" height="279" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" alt="" width="697" height="123" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/85/Lzuinter_(2).png" alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/56/Lzuinter_(3).png" alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/89/Lzuinter_(1).png" alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who would be an author on any resulting publication. For example, your faculty advisor may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this will often be a range of dates; make sure you say which data was taken at what times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on 2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed successfully on different date. Device 1 took more time, about 7 days and was got on October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your instrument as configured for these measurements? (e.g., a meter stick measures in the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/7/71/LZUIMAGE6.png" alt="" width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" width="697" height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T20:41:40Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " <br />
<br />
http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软<br />
<br />
雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col<br />
<br />
{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 <br />
<br />
0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba<br />
<br />
(0,0,0,0.7);color:white;font-style:normal;line-<br />
<br />
height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-<br />
<br />
size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; <br />
<br />
overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; <br />
<br />
height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; <br />
<br />
font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; <br />
<br />
position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px <br />
<br />
rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; <br />
<br />
position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-<br />
<br />
shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, <br />
<br />
.visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar <br />
<br />
(edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, <br />
<br />
#menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) <br />
<br />
--*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,bu<br />
<br />
tton,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-<br />
<br />
size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 <br />
<br />
tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box<br />
<br />
-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-<br />
<br />
icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-<br />
<br />
bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-<br />
<br />
bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-<br />
<br />
style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) <br />
<br />
transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, <br />
<br />
255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-<br />
<br />
align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px <br />
<br />
1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas<br />
<br />
{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha<br />
<br />
(opacity=0)}<br />
.hd-main .logo{background-image:url<br />
<br />
('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-<br />
<br />
repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background<br />
<br />
-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info <br />
<br />
a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-<br />
<br />
color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate<br />
<br />
{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft <br />
<br />
JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover<br />
<br />
{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-<br />
<br />
top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-<br />
<br />
align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 <br />
<br />
auto;width:50px;height:50px;display:block;background:url<br />
<br />
('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url<br />
<br />
('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px <br />
<br />
"Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-<br />
<br />
icon<br />
<br />
{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-<br />
<br />
size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-<br />
<br />
weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-<br />
<br />
color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-<br />
<br />
top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-<br />
<br />
block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px <br />
<br />
solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-<br />
<br />
bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow<br />
<br />
{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-<br />
<br />
size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-<br />
<br />
space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-<br />
<br />
align:bottom}<br />
.hd-main .info .user-name .identity<br />
<br />
{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -<br />
<br />
88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-<br />
<br />
24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-<br />
<br />
position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font<br />
<br />
-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background<br />
<br />
-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px <br />
<br />
0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a<br />
<br />
{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content <br />
<br />
a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li<br />
<br />
{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li<br />
<br />
{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px <br />
<br />
solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; <br />
<br />
font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:9088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:8977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img <br />
<br />
src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" <br />
<br />
height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" <br />
<br />
xml:lang="EN-US">In our interlab work we test the three required parts. They <br />
<br />
are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-<br />
<br />
US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&n<br />
<br />
bsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-<br />
<br />
E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-<br />
<br />
US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&n<br />
<br />
bsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032<br />
<br />
-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span <br />
<br />
lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-<br />
<br />
US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + <br />
<br />
BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well <br />
<br />
24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/f/f7/Interlab_image002.jpg" alt="" width="531" height="240" <br />
<br />
v:shapes="_x0000_i1025" /></div><br />
<br />
<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nb<br />
<br />
sp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nb<br />
<br />
sp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nb<br />
<br />
sp;Figure-1 The gel picture of each device</p><br />
<div><img src="https://2014.igem.org/File:LZUimage003.png" alt="" <br />
<br />
width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" <br />
<br />
xml:lang="EN-<br />
<br />
US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&n<br />
<br />
bsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&n<br />
<br />
bsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&n<br />
<br />
bsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&n<br />
<br />
bsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each <br />
<br />
lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN<br />
<br />
-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf <br />
<br />
tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span <br />
<br />
lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-<br />
<br />
US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span <br />
<br />
lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence <br />
<br />
microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was <br />
<br />
transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then <br />
<br />
we detected the number of green light spot by software. The final result is the <br />
<br />
average light spot , which are more bright than G value 192 for 3 random sites of <br />
<br />
each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used <br />
<br />
to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/a/a9/LZUimage005.png" width="520" <br />
<br />
height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture <br />
<br />
1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 <br />
<br />
are the device 3's. Each picture is 400x and we calculated the light spot. The <br />
<br />
result are listed here:</p><br />
<div><img src="https://2014.igem.org/File:LZUIMAGE4.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/3e/Image006.png" alt="" <br />
<br />
width="569" height="279" /></div><br />
<br />
<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot <br />
<br />
number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" alt="" <br />
<br />
width="697" height="123" /></div><br />
<br />
<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard <br />
<br />
deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<br />
<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nb<br />
<br />
sp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect <br />
<br />
the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is <br />
<br />
Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/85/Lzuinter_%282%29.png" <br />
<br />
alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/56/Lzuinter_%283%29.png" <br />
<br />
alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/89/Lzuinter_%281%29.png" <br />
<br />
alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who <br />
<br />
would be an author on any resulting publication. For example, your faculty advisor <br />
<br />
may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this <br />
<br />
will often be a range of dates; make sure you say which data was taken at what <br />
<br />
times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the <br />
<br />
simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on <br />
<br />
2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in <br />
<br />
publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: <br />
<br />
Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, <br />
<br />
illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the <br />
<br />
fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from <br />
<br />
the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria <br />
<br />
had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, <br />
<br />
optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed <br />
<br />
successfully on different date. Device 1 took more time, about 7 days and was got on <br />
<br />
October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 <br />
<br />
days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We <br />
<br />
cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of <br />
<br />
instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with <br />
<br />
this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select <br />
<br />
the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured <br />
<br />
Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), <br />
<br />
report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base <br />
<br />
units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your <br />
<br />
instrument as configured for these measurements? (e.g., a meter stick measures in <br />
<br />
the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-<br />
<br />
255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter <br />
<br />
stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it <br />
<br />
differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The <br />
<br />
method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: <br />
<br />
Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the <br />
<br />
sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN<br />
<br />
-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-<br />
<br />
9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly <br />
<br />
measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar <br />
<br />
file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from <br />
<br />
measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/7/71/LZUIMAGE6.png" alt="" <br />
<br />
width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, <br />
<br />
report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the <br />
<br />
set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-<br />
<br />
US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span <br />
<br />
lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-<br />
<br />
9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are <br />
<br />
excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span <br />
<br />
lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN<br />
<br />
-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for <br />
<br />
each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/16/LZUIMAGE7.png" width="697" <br />
<br />
height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
<br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" <br />
<br />
height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" <br />
<br />
width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" <br />
<br />
width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-<br />
<br />
China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-<br />
<br />
icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" <br />
<br />
href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" <br />
<br />
href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" <br />
<br />
href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" <br />
<br />
href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-<br />
<br />
China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" <br />
<br />
href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future <br />
<br />
Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-<br />
<br />
China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-<br />
<br />
China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. <br />
<br />
Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" <br />
<br />
href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team <br />
<br />
Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-<br />
<br />
China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-<br />
<br />
China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-<br />
<br />
China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-<br />
<br />
China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-<br />
<br />
height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-<br />
<br />
height"></span><br />
<span class="li"><a href="">Team <br />
<br />
Profile</a></span><br />
<span class="li"><a <br />
<br />
href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a <br />
<br />
href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft <br />
<br />
YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { <br />
<br />
v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; <br />
<br />
}<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/File:Interlab_image002.jpg
File:Interlab image002.jpg
2014-10-17T20:40:30Z
<p>Lzuzx: </p>
<hr />
<div></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/NotebookB
Team:LZU-China/NotebookB
2014-10-17T20:32:09Z
<p>Lzuzx: Created page with "<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns=" http://www.w3.org/1999/xhtml"> <head> <me..."</p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4988px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:4877px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /></a> <img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></a></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF WET LAB GROUP </td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;March 2014<br /><br />
Buy 300ml each chamber big MFC, buy multimeter, stainless steel, enameled wire. Buy PEM(proton exchange membrane) membrane and use H2O2 and H2SO4 boiled solution handle the PEM.<br /><br />
<img width="554" height="415" src="https://static.igem.org/mediawiki/2014/c/ca/Old_big_MFC.png" /><br clear="all" /><br />
first appliance, and it is the biggest one. We use it and incubate a PNP endurance bacteria named LZU-3.We hoped that LZU-3 could degrade potassium dichromate, but we failed.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;April/June 2014<br /><br />
We prepared anode medium and cathode medium, incubate the <em>Pseudomonas aeruginosa</em> and <em>Shewanella oneidensis</em> and LZU-3. Testing the big MFC devices and collected the data.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>July 2014<br /><br />
We tried to research how dose PNP influence the MFC power output. We buy 4 others MFC devices from internet, and prepare PEM carbon brush for it.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/6/6e/Old_MFC_photo.png" width="670" height="502" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>August 2014<br /><br />
We designed our own device and tried our best to manufacture the new MFC. We tested the performance of these 11 MFC devices. Different sizes(from 160*160*80 mm to 25*25*25 mm) were used in our experiment. At last we found that 50*50*50 mm is the best size of this battery. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/5/5b/MFC_crystal.png" width="592" height="444" /></p><br />
<p>&nbsp;&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;In September and October, we run our MFCs and gain a lot of data, we tried to figure out, dose riboflavin can stimulate the MFC power output, and, how accuracy did the genetically engineered E.coli response to the PNP concentration. we worked out empirical curves about the relationship between PNP concentration and output voltage.</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/1/1e/AutoCAD_MFC.png" width="671" height="500" /></p><br />
<p>&nbsp;</p><br />
<p>We also measured the riboflavin expression data of the genatically modified E.coli.</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/f/fb/Rib_curve.png" width="611" height="390" /></p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/f/f5/Final_data.png" width="626" height="469" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T20:26:50Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:9088px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:8977px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/9/91/7interlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="70%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p>&nbsp;</p><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Result</span></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="LZUimage005.png" width="520" height="429" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Picture 1-3 are the device 1's results, Picture 4-6 are the device 2's and the Picture 7-9 are the device 3's. Each picture is 400x and we calculated the light spot. The result are listed here:</p><br />
<div><img src="LZUIMAGE4.png" alt="" width="653" height="282" /></div><br />
<p>&nbsp;</p><br />
<div><img src="image006.png" alt="" width="569" height="279" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 The &quot;light&quot; spot number of each devices</p><br />
<p>&nbsp;</p><br />
<div><img src="LZUIMAGE7.png" alt="" width="697" height="123" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Table-3 The mean and standard deviation of each device <br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Besides, we used the cytoflower to detect the number of cells with green fluorescence. The result is here:<br />
(Tube 001 is the control. Tube 002 and 003 are Device 2 . Tube 004 is Device 1 and Tube 005 is Device 3. )</p><br />
<div><img src="lzuinter (2).png" alt="" width="401" height="514" /></div><br />
<p>&nbsp;</p><br />
<div><img src="lzuinter (3).png" alt="" width="436" height="515" /></div><br />
<p>&nbsp;</p><br />
<div><img src="lzuinter (1).png" alt="" width="465" height="272" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div>Section I: Provenance &amp; Release</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.Who did the actual work to acquire these measurements?</p><br />
<p> Qi Wu, Hongxia Zhao and Ruixue Zhao.</p><br />
<p>&nbsp;</p><br />
<p>2.What other people should be credited for these measurements? (i.e., who would be an author on any resulting publication. For example, your faculty advisor may have helped design the protocols that you ran.)</p><br />
<p> Xiangkai Li will be the &quot;corresponding author&quot;.</p><br />
<p>&nbsp;</p><br />
<p>3.On what dates were the protocols run and the measurements taken? (this will often be a range of dates; make sure you say which data was taken at what times.)</p><br />
<p> We ran the protocol on2014.10.4 because of the mistake and we took the simple fluorescence data on 2014.10.16. The data made by flow cytometer was got on 2014.10.17.</p><br />
<p>&nbsp;</p><br />
<p>4.Do all persons involved consent to the inclusion of this data in publications derived from the iGEM interlab study?</p><br />
<p> Yes.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><strong><span lang="EN-US" xml:lang="EN-US">S<em>ection II: Protocol</em></span></strong></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>1.What protocol did you use to prepare samples for measurement?</p><br />
<p> We used the Biobrick protocol to assembly and the strain was DH5 Alpha.</p><br />
<p>&nbsp;</p><br />
<p>2.What sort of instrument did you use to acquire measurements?</p><br />
<p>o What is the model and manufacturer?</p><br />
<p> Fluorescence microscope is Nikon OPTIPHOT-2 .</p><br />
<p>o How is it configured for your measurements? (e.g., light filters, illumination, amplification)</p><br />
<p> The microscope's exciting light was set as 492nm. </p><br />
<p>&nbsp;</p><br />
<p>3.What protocol did you use to take measurements?</p><br />
<p> The transformed E coli. Was shaken cultured about 17h and we took photo by the fluorescence microscope.Then we analyzed the number of light spots by software.</p><br />
<p>&nbsp;</p><br />
<p>4.What method is used to determine whether to include or exclude each sample from the data set?</p><br />
<p> After the scoping we did electrophoresis for each tube to exam if the bacteria had been transformed.</p><br />
<p>&nbsp;</p><br />
<p>5.What exactly were the controls that you used?</p><br />
<p> DH5 Alpha without transforming which had been shaken cultured for 17h.</p><br />
<p>&nbsp;</p><br />
<p>6.What quantities were measured? (e.g., red fluorescence, green fluorescence, optical density)</p><br />
<p> Green fluorescence. For the three reporters are all GFP.</p><br />
<p>&nbsp;</p><br />
<p>7.How much time did it take to acquire each set of measurements?</p><br />
<p> The data was got on the same day. While different device was transformed successfully on different date. Device 1 took more time, about 7 days and was got on October 13th. Device 2 and 3 were transformed successfully on 10.14, only taking 3 days.</p><br />
<p>&nbsp;</p><br />
<p>8.How much does it cost to acquire a set of measurements?</p><br />
<p> We did not calculate this carefully and we can just give a estimated value. We cost about 1300RMB for this measurement, 800 for the reagent and 500 for the use of instrument.</p><br />
<p>&nbsp;</p><br />
<p>9.What are the practical limits on the number or rate of measurements taken with this instrument and protocol?</p><br />
<p> pSB3K3 has a lower copy number so we had to cultured it for more times to select the colony of Device 1.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section III: Measured Quantities</span></em></strong></div><br />
<p><br />
<p><br />
<p>1.For each type of quantity measured (e.g., fluorescence, optical density), report on the following:<br />
<p>&nbsp;</p><br />
<p>2.Units:</p><br />
<p>o What are the units of the measurement? (e.g., meters, molecules)</p><br />
<p> The number of light spot.</p><br />
<p>o What is the equivalent unit expressed as a combination of the seven SI base units? (http://en.wikipedia.org/wiki/SI_base_unit)</p><br />
<p> We just calculated the number, it does not need the SI unit.</p><br />
<p>&nbsp;</p><br />
<p>3.Precision: </p><br />
<p>o What is the range of possible measured values for this quantity, using your instrument as configured for these measurements? (e.g., a meter stick measures in the range of 0 to 1 meter)</p><br />
<p> The spot number is always rational number while the RGB G value range is 0-255.</p><br />
<p>o What are the significant figures for these measurement? (e.g., on a meter stick, it is common to measure to the nearest millimeter).</p><br />
<p> Both the number and G value has the precision of 1.</p><br />
<p>o Is the precision the same across the entire range? If not, how does it differ?</p><br />
<p> Yes.</p><br />
<p>o How did you determine these answers?</p><br />
<p> Our method determined that we couldn't get a discrete result like 0.002. The method is counting instead of detect.</p><br />
<p>&nbsp;</p><br />
<p>4.Accuracy:</p><br />
<p>o When was the instrument last calibrated?</p><br />
<p> 2014.8.11.</p><br />
<p>o How was the instrument calibrated?</p><br />
<p> Calibrating the light source by raster correction<br /><br />
</p><br />
<p><br />
<p><br />
<div><strong><em><span lang="EN-US" xml:lang="EN-US">Section IV: Measurements</span></em></strong></div><br />
<p><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">1.For each sample, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of the sample</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></em><strong><span lang="EN-US" xml:lang="EN-US">1-3:Device1; 4-6:Device2; 7-9:Device3.<em></em></span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity directly measured</span></em></li><br />
</ul><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">They are saved as picture in the .rar file.</span></strong></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">each quantity derived from measurements (e.g., fluorescence/OD)</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="LZUIMAGE6.png" alt="" width="654" height="272" /></div><br />
<p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">2.For each group of replicates, report:</span></em><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the identity of samples in the set</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;1-3:Device1; 4-6:Device2; 7-9:Device3.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">which, if any, of the samples are excluded and why</span></em></li><br />
</ul><br />
</ul><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><strong><span lang="EN-US" xml:lang="EN-US">No excluded sample.</span></strong><em><span lang="EN-US" xml:lang="EN-US"></span></em></p><br />
<ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<span lang="EN-US" xml:lang="EN-US">o </span><br />
<!--[endif]--><br />
<em><span lang="EN-US" xml:lang="EN-US">the mean and standard deviation for each quantity measured or derived</span></em></li><br />
</ul><br />
</ul><br />
<div><img src="LZUIMAGE7.png" width="697" height="123" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="15%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/interlab
Team:LZU-China/interlab
2014-10-17T19:58:30Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:704px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 16px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:3488px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:3377px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/f/fe/1.background.top.jpg/800px-1.background.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="22%">&nbsp;</td><br />
<td width="56%"><p>&nbsp;</p><br />
<div>Our Interlab</div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<span lang="EN-US" xml:lang="EN-US">In our interlab work we test the three required parts. They are:</span></p><br />
<p>&nbsp;</p><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">1.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_I20260 (J23101-B0032-E0040-B0015) Plate 4,Well 18A</span></strong> </li><br />
</ul><br />
<ul><br />
<li><br />
<!--[if !supportLists]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">2.</span></strong><br />
<!--[endif]--><br />
<strong><span lang="EN-US" xml:lang="EN-US">BBa_J23101 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 20K and Plate 2,Well 24B</span></strong><strong><span lang="EN-US" xml:lang="EN-US">&nbsp;</span></strong></li><br />
</ul><br />
<p><strong><span lang="EN-US" xml:lang="EN-US">3.BBa_J23115 + BBa_E0240 (B0032-E0040-B0015) Plate 1,Well 22I and Plate 2,Well 24B</span></strong></p><br />
<p>&nbsp;</p><br />
<div>The gel picture of each device</div><br />
<p>&nbsp;</p><br />
<div><img src="interlab_image002.jpg" alt="" width="531" height="240" v:shapes="_x0000_i1025" /></div><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The gel picture of each device</p><br />
<div><img src="LZUimage003.png" alt="" width="408" height="369" v:shapes="_x0000_i1025" /></div><br />
<p><span lang="EN-US" xml:lang="EN-US"> </span><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Table-1 Each lane&rsquo;s properties</span></p><br />
<p>&nbsp;</p><br />
<div><span lang="EN-US" xml:lang="EN-US">Protocol</span></div><br />
<p><span lang="EN-US" xml:lang="EN-US">Equipment and chemicals</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; 20</span><span lang="EN-US" xml:lang="EN-US">&mu;</span><span lang="EN-US" xml:lang="EN-US">L eppendorf tubes x9</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; ddH2O</span></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">&nbsp;</span><span lang="EN-US" xml:lang="EN-US">Competent </span><em><span lang="EN-US" xml:lang="EN-US">E.Coli </span></em></p><br />
<p><em><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; </span></em><span lang="EN-US" xml:lang="EN-US">The devices</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Fluorescence microscope.</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">Methods:</span></p><br />
<p><span lang="EN-US" xml:lang="EN-US">&nbsp;&nbsp; Each device was transformed in competent <em>E.Coli </em>and shaken cultured at 37℃ for 18h. Then we detected the number of green light spot by software. The final result is the average light spot , which are more bright than G value 192 for 3 random sites of each site by the </span><span lang="EN-US" xml:lang="EN-US">algorithm which we used to developed.</span></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/82/Bga2.png" width="600" height="400" /></div><br />
<div><img src="https://static.igem.org/mediawiki/2014/0/0d/Bga3.png" width="754" height="312" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Microorganisms can degrade pollutants and produce electricity, so we aimed to produce microbial fuel cells (MFCs) to deal with the pollutant and generate electricity. This is really a new kind of technology for human because the world best MFCs can only run a tiny toy engine, so this should be have a bright future when it comes into practice.<br /><br />
At first, we construct a normal MFC, using Shewanella oneidensi to generate electricity and reduce sewage with heavy metal ions, during several experiments we found that MFCs running in traditional way have many disadvantages. These two we will mention as following are extremely serious.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;One is that pollutant, for example, p-Nitrophenol(PNP), exists in common sewage, always impede the electricity generation of MFC. </p><br />
<div><img src="https://static.igem.org/mediawiki/2014/d/df/Bga4.png" width="579" height="255" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Another drawback is that all kinds of traditional MFCs are hard to show the contaminants concentrations. In the past, some scientist and engineers had to use costly method for example High Performance Liquid Chromatography (HPLC) measure the substrate concentration. This is also a major drawback for MFCs applications.</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/12/Bga5.png" width="325" height="274" /></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;But how can we deal with these two kinds of problems? We noticed that if we could modify the gene of bacteria used in MFCs to fight against the negative effect of pollutant and invented a series of hardware and software to monitor the substrate concentration of MFCs, these two kinds of problems would be overcame successfully. So we registered iGEM 2014 to develop a novel MFCs system that can measure substrates concentrations using genetic engineered bacteria. This is a new concept not only simply for PNP problem, but also it is a standard model for all kinds of pollutant treatment and real-time substrate concentration monitoring.</p><br />
<p><div><img src="https://static.igem.org/mediawiki/2014/5/59/Bga6.png" width="500" height="115" /></div>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br /><br />
</p></td><br />
<td width="22%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/NotebookC
Team:LZU-China/NotebookC
2014-10-17T19:39:56Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:10704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5488px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:5377px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:610px;<br />
top:6246px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /></a> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF DRY LAB GROUP</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;</p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In January, We began to know the concept of iGEM introduced by Wang Han and Prof. Yang and began to recruit our members.<br /><br />
We found some useful papers to create our own idea.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;<br />
<div><br />
<div class='picList6'><br />
<div class='col'> <img src='https://static.igem.org/mediawiki/2014/d/db/Z.c1.png' alt=""/><a href='#'>Recruiting team members<br/>We are the chosen 12 from hundreds of student. Each of us have special skills to attend this race.</a></div><br />
</div><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
var temp=357;<br />
$('.picList6 .col').hover(function(){<br />
$(this).find('a').stop(true).animate({top: temp=(temp==0?357:0) });<br />
});<br />
</script><br />
</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After March, we began to design our logo, and human practice was kicked off. Xuejing Du began to design his survey and translate the questionnaire into English. Hongxia Zhao gave a lecture to young students. In April when serious benzene pollution burst in Lanzhou, we collect the news about that.</p><br />
<p>&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/b/b9/Z.c2.png" width="300" height="399" />&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/c7/Z.c3.png" width="400" height="300" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/7/7a/Z.c4.png" width="600" height="400" />&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After April, we began to look for appropriate voltmeter on the market and gave them an extensive evaluation. Finally, we chose the UNI-T UT800 Series of high precision digital bench-type multimeter because of its accurate performance. What's more to make the multimeter can work better with the computer, Xiao Zhang chose the Z-TEK RS232 to USB cable to link the voltage meters to the computer.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After June in summer, we tried to design our software using LabView, meanwhile website designing was underway. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/f/f5/Z.c7.png" width="289" height="134" />&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/thumb/b/b7/Z.c6.png/522px-Z.c6.png" width="553" height="635" />&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;When August came, we attend to CCiC, and started with survey result collection in China.</p><br />
<p>In September, we collected the results from UK and did the data analyses. For detail, please see our questionnaire link http://www.wenjuan.com/s/RVBVzu/#jtss-qzone)</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/9/97/Z.c10.png" width="473" height="404" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In September, Xiao released the second version of our application.</p><br />
<p>&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/6/63/App1.png" alt="" width="328" height="582" />&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/5/5d/App0.png" alt="" width="328" height="582" />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In October, the result has been found by our group and we began to design our poster</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/2b/Z.c8.png" width="600" height="563" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
<p>&nbsp;</p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/NotebookC
Team:LZU-China/NotebookC
2014-10-17T19:36:33Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:10704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5388px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:5277px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:610px;<br />
top:6246px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /></a> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF DRY LAB GROUP</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;</p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In January, We began to know the concept of iGEM introduced by Wang Han and Prof. Yang and began to recruit our members.<br /><br />
We found some useful papers to create our own idea.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;<br />
<div><br />
<div class='picList6'><br />
<div class='col'> <img src='https://static.igem.org/mediawiki/2014/d/db/Z.c1.png' alt=""/><a href='#'>Recruiting team members<br/>We are the chosen 12 from hundreds of student. Each of us have special skills to attend this race.</a></div><br />
</div><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
var temp=357;<br />
$('.picList6 .col').hover(function(){<br />
$(this).find('a').stop(true).animate({top: temp=(temp==0?357:0) });<br />
});<br />
</script><br />
</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After March, we began to design our logo, and human practice was kicked off. Xuejing Du began to design his survey and translate the questionnaire into English. Hongxia Zhao gave a lecture to young students. In April when serious benzene pollution burst in Lanzhou, we collect the news about that.</p><br />
<p>&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/b/b9/Z.c2.png" width="300" height="399" />&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/c7/Z.c3.png" width="400" height="300" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/7/7a/Z.c4.png" width="600" height="400" />&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After April, we began to look for appropriate voltmeter on the market and gave them an extensive evaluation. Finally, we chose the UNI-T UT800 Series of high precision digital bench-type multimeter because of its accurate performance. What's more to make the multimeter can work better with the computer, Xiao Zhang chose the Z-TEK RS232 to USB cable to link the voltage meters to the computer.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After June in summer, we tried to design our software using LabView, meanwhile website designing was underway. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/f/f5/Z.c7.png" width="289" height="134" />&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/thumb/b/b7/Z.c6.png/522px-Z.c6.png" width="553" height="635" />&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;When August came, we attend to CCiC, and started with survey result collection in China.</p><br />
<p>In September, we collected the results from UK and did the data analyses. For detail, please see our questionnaire link http://www.wenjuan.com/s/RVBVzu/#jtss-qzone)</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/9/97/Z.c10.png" width="473" height="404" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In September, Xiao released the second version of our application.</p><br />
<p>&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/6/63/App1.png" alt="" width="328" height="582" />&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/5/5d/App0.png" alt="" width="328" height="582" />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In October, the result has been found by our group and we began to design our poster</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/2b/Z.c8.png" width="600" height="563" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p> <p>&nbsp;</p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/NotebookC
Team:LZU-China/NotebookC
2014-10-17T19:35:53Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:10704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5388px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:5277px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:680px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:610px;<br />
top:6246px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><a href="https://2014.igem.org/Team:LZU-China/Notebook"><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /></a> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF DRY LAB GROUP</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;</p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In January, We began to know the concept of iGEM introduced by Wang Han and Prof. Yang and began to recruit our members.<br /><br />
We found some useful papers to create our own idea.<br /><br />
</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="10%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;<br />
<div><br />
<div class='picList6'><br />
<div class='col'> <img src='https://static.igem.org/mediawiki/2014/d/db/Z.c1.png' alt=""/><a href='#'>Recruiting team members<br/>We are the chosen 12 from hundreds of student. Each of us have special skills to attend this race.</a></div><br />
</div><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
var temp=357;<br />
$('.picList6 .col').hover(function(){<br />
$(this).find('a').stop(true).animate({top: temp=(temp==0?357:0) });<br />
});<br />
</script><br />
</div></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After March, we began to design our logo, and human practice was kicked off. Xuejing Du began to design his survey and translate the questionnaire into English. Hongxia Zhao gave a lecture to young students. In April when serious benzene pollution burst in Lanzhou, we collect the news about that.</p><br />
<p>&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/b/b9/Z.c2.png" width="300" height="399" />&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/c7/Z.c3.png" width="400" height="300" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/7/7a/Z.c4.png" width="600" height="400" />&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After April, we began to look for appropriate voltmeter on the market and gave them an extensive evaluation. Finally, we chose the UNI-T UT800 Series of high precision digital bench-type multimeter because of its accurate performance. What's more to make the multimeter can work better with the computer, Xiao Zhang chose the Z-TEK RS232 to USB cable to link the voltage meters to the computer.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;After June in summer, we tried to design our software using LabView, meanwhile website designing was underway. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/f/f5/Z.c7.png" width="289" height="134" />&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/thumb/b/b7/Z.c6.png/522px-Z.c6.png" width="553" height="635" />&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;When August came, we attend to CCiC, and started with survey result collection in China.</p><br />
<p>In September, we collected the results from UK and did the data analyses. For detail, please see our questionnaire link http://www.wenjuan.com/s/RVBVzu/#jtss-qzone)</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/9/97/Z.c10.png" width="473" height="404" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In September, Xiao released the second version of our application.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/6/63/App1.png" alt="" width="328" height="582" />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/5/5d/App0.png" alt="" width="328" height="582" />&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In October, the result has been found by our group and we began to design our poster</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/2b/Z.c8.png" width="600" height="563" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p><br />
<p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p> <p>&nbsp;</p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Notebook
Team:LZU-China/Notebook
2014-10-17T19:26:29Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:6288px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:6177px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:670px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></a></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF WET LAB GROUP A</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.5.16-5.23<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The pre-experience of the growth of three strains(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li&rsquo;s lab )in different PNP concentration and Cr(VI) concentration.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/f/f5/Z.da1.png" width="700" height="173" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.5.24-5.31<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Measurement for three strains&rsquo;(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li&rsquo;s lab ) Cr(VI) reduction activity.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/thumb/d/dc/Z.a2.png/463px-Z.a2.png" width="467" height="605" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.6.1-2014.6.8<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.Another measurement for three strains&rsquo;(as above said) Cr(VI) reduction activity.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/a/a6/Z.a3.png" width="569" height="482" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Construction of the phylogeny tree containing the LZU-3 </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/5/52/Z.4.png" width="654" height="503" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.6.8-2014.7.24<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The PCR cycling for BBa_I723020 and BBa_I723133</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1. The primers(synthesized by BGI,shenzhen)</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.1 Promoter of BBa_I723133 <br /><br />
The forward primer (5&rsquo; TATACTAGTCTGGGGCGAGAGGCGACGAC 3&rsquo;) contained a SpeI cutsite <br /><br />
The reverse primer (5&rsquo; GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3&rsquo;) contained a EcoRI and XbaI cutsite. <br /><br />
2313bp</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.2 BBa_I723020<br /><br />
The forward primer (5&rsquo;GGTGCTGCAGACTAGTATTGAAGGGTCACCACTATTTTTATTTTA 3&rsquo;) containes SpeI and PstI cutsites <br /><br />
the reverse primer (5&rsquo; ATGAATTCTCTAGACCTGCTGGAGGGCGTGAAC 3&rsquo;) containes EcoRI and XbaI cutsites. <br /><br />
340bp</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.The PCR system</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;0.2&mu;L ExTaq.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L bacterial liquid<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L dNTP<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L forward primer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L reverse primer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5&mu;L 10x Buffer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;18.5&mu;L ddH2O</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.7.31-8.1<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Pre-experience for the function of BBa_K381001.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;BBa_K381001 transformation to E.coli DH5 alpha<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;There are two groups to test the green fluorescence under microscope:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(These groups' total sizes are all 20&mu;L, had been shaken for 2hours before observation,400x)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP concentration.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with 20mM PNP concentration.<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/2d/Z.5.png" width="704" height="307" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.8.2-2014.8.6<br /><br />
Pre-experience for the function of BBa_K381001.<br /><br />
BBa_K381001 transformation to E.coli DH5 alpha<br /><br />
There are four groups to test the green fluorescence under microscope:<br /><br />
(These groups' total sizes are all 20&mu;L, had been shaken for 2hours before observation,1000x)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP concentration.b.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with ddH2O<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;c.bacterial liquid with 10mM KNO3<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;d.bacterial liquid with 10mM KCl.<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/4/41/Z.a6.png" width="455" height="340" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.8.25-9.21<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.Construction of BBa_K1523101<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/28/Z.a7.png" width="489" height="90" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5'---TTCCCATCTATAATCCTCCCTGATTCTTCG---3';anti-sense:5'---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3'). From the gel picture we can see the size is right.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/cf/Z.a8.png" width="643" height="305" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Construction of BBa_K1523024(yieF) and BBa_K1523005(chrR)</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.9.21-10.2<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Construction of BBa_K1523021(<em>nahR</em>), K1523022(<em>nahE</em>) and K1523023(<em>nahG</em>).</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p>&nbsp;</p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Notebook
Team:LZU-China/Notebook
2014-10-17T19:24:21Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:6288px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:6177px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:640px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></a></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF WET LAB GROUP A</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.5.16-5.23<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The pre-experience of the growth of three strains(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li&rsquo;s lab )in different PNP concentration and Cr(VI) concentration.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/f/f5/Z.da1.png" width="700" height="173" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.5.24-5.31<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Measurement for three strains&rsquo;(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li&rsquo;s lab ) Cr(VI) reduction activity.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/thumb/d/dc/Z.a2.png/463px-Z.a2.png" width="467" height="605" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.6.1-2014.6.8<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.Another measurement for three strains&rsquo;(as above said) Cr(VI) reduction activity.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/a/a6/Z.a3.png" width="569" height="482" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Construction of the phylogeny tree containing the LZU-3 </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/5/52/Z.4.png" width="654" height="503" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.6.8-2014.7.24<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The PCR cycling for BBa_I723020 and BBa_I723133</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1. The primers(synthesized by BGI,shenzhen)</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.1 Promoter of BBa_I723133 <br /><br />
The forward primer (5&rsquo; TATACTAGTCTGGGGCGAGAGGCGACGAC 3&rsquo;) contained a SpeI cutsite <br /><br />
The reverse primer (5&rsquo; GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3&rsquo;) contained a EcoRI and XbaI cutsite. <br /><br />
2313bp</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.2 BBa_I723020<br /><br />
The forward primer (5&rsquo;GGTGCTGCAGACTAGTATTGAAGGGTCACCACTATTTTTATTTTA 3&rsquo;) containes SpeI and PstI cutsites <br /><br />
the reverse primer (5&rsquo; ATGAATTCTCTAGACCTGCTGGAGGGCGTGAAC 3&rsquo;) containes EcoRI and XbaI cutsites. <br /><br />
340bp</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.The PCR system</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;0.2&mu;L ExTaq.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L bacterial liquid<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L dNTP<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L forward primer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L reverse primer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5&mu;L 10x Buffer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;18.5&mu;L ddH2O</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.7.31-8.1<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Pre-experience for the function of BBa_K381001.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;BBa_K381001 transformation to E.coli DH5 alpha<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;There are two groups to test the green fluorescence under microscope:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(These groups' total sizes are all 20&mu;L, had been shaken for 2hours before observation,400x)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP concentration.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with 20mM PNP concentration.<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/2d/Z.5.png" width="704" height="307" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.8.2-2014.8.6<br /><br />
Pre-experience for the function of BBa_K381001.<br /><br />
BBa_K381001 transformation to E.coli DH5 alpha<br /><br />
There are four groups to test the green fluorescence under microscope:<br /><br />
(These groups' total sizes are all 20&mu;L, had been shaken for 2hours before observation,1000x)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP concentration.b.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with ddH2O<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;c.bacterial liquid with 10mM KNO3<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;d.bacterial liquid with 10mM KCl.<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/4/41/Z.a6.png" width="455" height="340" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.8.25-9.21<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.Construction of BBa_K1523101<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/28/Z.a7.png" width="489" height="90" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5'---TTCCCATCTATAATCCTCCCTGATTCTTCG---3';anti-sense:5'---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3'). From the gel picture we can see the size is right.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/cf/Z.a8.png" width="643" height="305" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Construction of BBa_K1523024(yieF) and BBa_K1523005(chrR)</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.9.21-10.2<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Construction of BBa_K1523021(<em>nahR</em>), K1523022(<em>nahE</em>) and K1523023(<em>nahG</em>).</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br />
<p><br />
<p><br />
<p><br />
<p><br />
<p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/Notebook
Team:LZU-China/Notebook
2014-10-17T19:23:33Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
body,ul,li,ol{list-style:none;padding:0px;margin:0px;font-size:12px;font-family:微软雅黑;}<br />
img{border:0px;}<br />
.picList{width:100%;float:left;}<br />
.picList .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList .col img{width:100%;}<br />
.picList .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList2{width:100%;float:left;}<br />
.picList2 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList2 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList2 .col img{width:100%;}<br />
.picList2 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList3{width:100%;float:left;}<br />
.picList3 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList3 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList3 .col img{width:100%;}<br />
.picList3 .col a{<br />
display:block;<br />
width:580;<br />
height:377px;<br />
top:357px;<br />
background:rgba(0,0,0,0.7);<br />
color:white;<br />
font-style:normal;<br />
line-height:25px;<br />
padding:10px;<br />
opacity:0.8;<br />
text-decoration:none;<br />
}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList4{width:100%;float:left;}<br />
.picList4 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList4 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList4 .col img{width:100%;}<br />
.picList4 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList5{width:100%;float:left;}<br />
.picList5 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList5 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList5 .col img{width:100%;}<br />
.picList5 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList6{width:100%;float:left;}<br />
.picList6 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList6 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList6 .col img{width:100%;}<br />
.picList6 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList7{width:100%;float:left;}<br />
.picList7 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList7 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList7 .col img{width:100%;}<br />
.picList7 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
.picList8{width:100%;float:left;}<br />
.picList8 .col{width:600px;height:397px;position:relative;overflow:hidden;float:left;margin:10px 0 0 10px;}<br />
.picList8 .col img,.col a{position:absolute;top:0px;left:0px;}<br />
.picList8 .col img{width:100%;}<br />
.picList8 .col a{display:block;width:580;height:377px;top:357px;background:rgba(0,0,0,0.7);color:white;font-style:normal;line-height:25px;padding:10px;opacity:0.8;text-decoration:none;}<br />
.msg{float:left;width:900px;position:relative;left:50%;margin:30px 0 0 -450px;font-size:14px;}<br />
<br />
*{margin:0px;padding:0px;}<br />
body{background:#b1b1b1;margin:0px;padding:0px;font-size:14px;color:#000;}<br />
b#p1, b#p2, b#p3, b#p4, b#p5 {display:none;}<br />
#accordian {padding:0; margin:20px auto; list-style:none; width:730px; height:300px; overflow:hidden; position:relative; border:1px solid #682;}<br />
#accordian li {width:50px; height:300px; float:left;<br />
-moz-transition: 0.7s;<br />
-ms-transition: 0.7s;<br />
-o-transition: 0.7s;<br />
-webkit-transition: 0.7s;<br />
transition: 0.7s;<br />
}<br />
#accordian div {width:530px; height:300px; position:relative;}<br />
#accordian div span {display:block; background:rgba(0,0,0,.3); width:460px; height:30px; position:absolute; bottom:300px; right:0; padding:10px; color:#fff; font:normal 13px/30px 'georgia', serif; border-top:1px solid #000;<br />
}<br />
#accordian div span a {color:#fff;}<br />
#accordian li div > a {display:block; width:49px; height:300px; float:left; position:relative; color:#fff; text-decoration:none;box-shadow:-10px 0 10px -10px rgba(0,0,0,0.6);}<br />
#accordian li div > a b {display:block; width:280px; padding-left:20px; height:50px; position:absolute; left:50px; bottom:0; font:bold 24px/50px 'georgia', serif; text-shadow:0 0 2px rgba(0, 0, 0, 0.6);<br />
transform: rotate(-90deg);<br />
transform-origin:bottom left;<br />
-ms-transform: rotate(-90deg);<br />
-ms-transform-origin:bottom left;<br />
-webkit-transform: rotate(-90deg);<br />
-webkit-transform-origin:bottom left;<br />
-moz-transform: rotate(-90deg);<br />
-moz-transform-origin:bottom left;<br />
-o-transform: rotate(-90deg);<br />
-o-transform-origin:bottom left;<br />
}<br />
#accordian li div > a b {*left:0;}<br />
#accordian li img {display:block; float:left;}<br />
#accordian li.p1 {width:530px;}<br />
#accordian li.p1 div span {bottom:0;}<br />
#accordian li a.a1 {background:#b33866; border-left:1px solid #682;}<br />
#accordian li a.a2 {background:#8d4984; border-left:1px solid #9b5;}<br />
#accordian li a.a3 {background:#6559a1; border-left:1px solid #ce5;}<br />
#accordian li a.a4 {background:#3c6cc0; border-left:1px solid #ef7;}<br />
#accordian li a.a5 {background:#187adb; border-left:1px solid #28b;}<br />
#p1:target ~ #accordian li {width:50px;}<br />
#p1:target ~ #accordian li div span {bottom:300px;}<br />
#p1:target ~ #accordian li.p1 {width:530px;}<br />
#p1:target ~ #accordian li.p1 div span {bottom:0;}<br />
#p2:target ~ #accordian li {width:50px;}<br />
#p2:target ~ #accordian li div span {bottom:300px;}<br />
#p2:target ~ #accordian li.p2 {width:530px;}<br />
#p2:target ~ #accordian li.p2 div span {bottom:0;}<br />
#p3:target ~ #accordian li {width:50px;}<br />
#p3:target ~ #accordian li div span {bottom:300px;}<br />
#p3:target ~ #accordian li.p3 {width:530px;}<br />
#p3:target ~ #accordian li.p3 div span {bottom:0;}<br />
#p4:target ~ #accordian li {width:50px;}<br />
#p4:target ~ #accordian li div span {bottom:300px;}<br />
#p4:target ~ #accordian li.p4 {width:530px;}<br />
#p4:target ~ #accordian li.p4 div span {bottom:0;}<br />
#p5:target ~ #accordian li {width:50px;}<br />
#p5:target ~ #accordian li div span {bottom:300px;}<br />
#p5:target ~ #accordian li.p5 {width:530px;}<br />
#p5:target ~ #accordian li.p5 div span {bottom:0;}<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:328px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:9704px;<br />
width:100%;<br />
height:56px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:6288px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 46px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:6177px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 div {<br />
font-size: 14px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:660px;<br />
width:100%;<br />
height:470px;<br />
z-index:0;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv8 table tr td table tr td {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0px;<br />
top:6251px;<br />
width:100%;<br />
height:55px;<br />
z-index:4;<br />
}<br />
#apDiv9 table tr td table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 31px;<br />
}<br />
#apDiv4 table tr td table tr td div div {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv10 {<br />
position:absolute;<br />
left:0;<br />
top:6956px;<br />
width:1004px;<br />
height:539px;<br />
z-index:5;<br />
}<br />
#apDiv9 table tr td table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv11 {<br />
position:absolute;<br />
left:0;<br />
top:7440px;<br />
width:100%;<br />
height:140px;<br />
z-index:5;<br />
}<br />
#apDiv11 table tr td table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv11 table tr td table tr td p {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
#apDiv11 table tr td table tr td table tr td {<br />
font-size: 18px;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 18px;<br />
line-height: 32px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/9/99/9.notebook.top.jpg/800px-9.notebook.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="25%">&nbsp;</td><br />
<td><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&quot;Rome was not built in a day.&quot; No matter which group we belong to, we took our work for almost a whole year. What did we do on earth? This notebook will show you in detail.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/8/8f/Z.wabb%281%29.png" width="214" height="99" /> <a href="https://2014.igem.org/Team:LZU-China/NotebookB"><img src="https://static.igem.org/mediawiki/2014/e/e6/Z.wabb%282%29.png" width="215" height="99" /></a><a href="https://2014.igem.org/Team:LZU-China/NotebookC"><img src="https://static.igem.org/mediawiki/2014/0/0e/Z.wabb%283%29.png" width="212" height="99" /></a></div><br />
<p>&nbsp;</p></td><br />
<td width="25%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" align="center"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" >&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;THE NOTEBOOK OF WET LAB GROUP A</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.5.16-5.23<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The pre-experience of the growth of three strains(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li&rsquo;s lab )in different PNP concentration and Cr(VI) concentration.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/f/f5/Z.da1.png" width="700" height="173" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.5.24-5.31<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Measurement for three strains&rsquo;(<em>Shewanella onedensis,</em> <em>Pseudomonas aeruginosa </em>and LZU-3, which is separated in Li&rsquo;s lab ) Cr(VI) reduction activity.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/thumb/d/dc/Z.a2.png/463px-Z.a2.png" width="467" height="605" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.6.1-2014.6.8<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.Another measurement for three strains&rsquo;(as above said) Cr(VI) reduction activity.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/a/a6/Z.a3.png" width="569" height="482" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Construction of the phylogeny tree containing the LZU-3 </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/5/52/Z.4.png" width="654" height="503" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.6.8-2014.7.24<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The PCR cycling for BBa_I723020 and BBa_I723133</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1. The primers(synthesized by BGI,shenzhen)</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.1 Promoter of BBa_I723133 <br /><br />
The forward primer (5&rsquo; TATACTAGTCTGGGGCGAGAGGCGACGAC 3&rsquo;) contained a SpeI cutsite <br /><br />
The reverse primer (5&rsquo; GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3&rsquo;) contained a EcoRI and XbaI cutsite. <br /><br />
2313bp</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.2 BBa_I723020<br /><br />
The forward primer (5&rsquo;GGTGCTGCAGACTAGTATTGAAGGGTCACCACTATTTTTATTTTA 3&rsquo;) containes SpeI and PstI cutsites <br /><br />
the reverse primer (5&rsquo; ATGAATTCTCTAGACCTGCTGGAGGGCGTGAAC 3&rsquo;) containes EcoRI and XbaI cutsites. <br /><br />
340bp</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.The PCR system</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;0.2&mu;L ExTaq.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L bacterial liquid<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L dNTP<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L forward primer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1&mu;L reverse primer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.5&mu;L 10x Buffer<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;18.5&mu;L ddH2O</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.7.31-8.1<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Pre-experience for the function of BBa_K381001.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;BBa_K381001 transformation to E.coli DH5 alpha<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;There are two groups to test the green fluorescence under microscope:<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(These groups' total sizes are all 20&mu;L, had been shaken for 2hours before observation,400x)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP concentration.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with 20mM PNP concentration.<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/2d/Z.5.png" width="704" height="307" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.8.2-2014.8.6<br /><br />
Pre-experience for the function of BBa_K381001.<br /><br />
BBa_K381001 transformation to E.coli DH5 alpha<br /><br />
There are four groups to test the green fluorescence under microscope:<br /><br />
(These groups' total sizes are all 20&mu;L, had been shaken for 2hours before observation,1000x)<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP concentration.b.<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with ddH2O<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;c.bacterial liquid with 10mM KNO3<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;d.bacterial liquid with 10mM KCl.<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/4/41/Z.a6.png" width="455" height="340" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.8.25-9.21<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;1.Construction of BBa_K1523101<br /><br />
</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/2/28/Z.a7.png" width="489" height="90" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5'---TTCCCATCTATAATCCTCCCTGATTCTTCG---3';anti-sense:5'---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3'). From the gel picture we can see the size is right.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/cf/Z.a8.png" width="643" height="305" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2.Construction of BBa_K1523024(yieF) and BBa_K1523005(chrR)</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;2014.9.21-10.2<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Construction of BBa_K1523021(<em>nahR</em>), K1523022(<em>nahE</em>) and K1523023(<em>nahG</em>).</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><br />
<p><br />
<p><br />
<p><br />
<p><br />
<p><br />
<p> </td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab4
Team:LZU-China/wetlab4
2014-10-17T19:21:41Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:4677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:3200px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3931px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="75%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="50">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;DESIGN AND CREATE MFC DEVICES</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p><strong>MFC Assembly and Operation.</strong></p><br />
<p>&nbsp;</p><br />
<p>Generally speaking a MFC has two electrodes, an anode and a cathode, a proton exchange membrane and a circuit pathway linking the two electrodes for the electron transfer from anode to cathode. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/47/MFC_sketch.png" width="555" height="479" /></p><br />
<p>Figure-11. Schematic diagram of a typical two-chamber microbial fuel cell(<a href="#_ENREF_1" title="Du, 2007 #10">Du et al., 2007</a>) </p><br />
<p>&nbsp;</p><br />
<p>The catholyte in all experiments was an unstirred 50 mM potassium ferricyanide solution in 100 mM phosphate buffer (pH=7.4), which was continuously open to air. The MFC design with carbon brush electrodes is shown in Figure 12. Brush anodes were made of carbon fibers (Haoshi carbon fiber, Lanzhou, Gansu, China) cut to a 3cm length and wound using a simple brush manufacturing system into a twisted core consisting of two titanium wires.</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/d/d5/MFC_components.png" alt="" width="455" height="340" /></div><br />
<p>&nbsp;</p><br />
<p>Figure-12. Components of MFC devices we previously used.</p><br />
<p>&nbsp;</p><br />
<div><br />
<p>&nbsp;</p><br />
<p>We designed a kind of cube-like two chamber MFC device, reference others&rsquo; single-chamber researches(<a href="#_ENREF_3" title="Logan, 2007 #76">Logan, Cheng, Watson, &amp; Estadt, 2007</a>). The cube was like a symmetrical 5&times;5&times;5cm polymethyl methacrylate cube, each chamber has two hole to aerate or load medium, each cylindrical chamber has 30ml with 4cm diameter, the blue print was shown in figure 13 . The white latex rubber gaskets were applied between every component of MFC devices to seal (figure 14).</p><br />
</div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/1e/AutoCAD_MFC.png" alt="" width="455" height="340" /></div><br />
<p>&nbsp;</p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure 13. Blue print (3 views) of one MFC component design.</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/5b/MFC_crystal.png" alt="" width="455" height="340" /><br clear="all" /><br />
Figure-14. A blank MFC device without carbon brush.</div><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Microbiological Methods<br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;It&rsquo;s reported that Shewanella, a well-known star of electricity-producing bacteria family, can secretes riboflavin that mediate extracellular electron transfer (<a href="#_ENREF_4" title="Marsili, 2008 #75">Marsili et al., 2008</a>) , additionally, this amazing bacteria can produce electrically conductive pilus-like appendages called directly transfer electric charge by touching relative remote anode material(<a href="#_ENREF_2" title="Gorby, 2006 #49">Gorby et al., 2006</a>) . So we buy standard bacteria strain, Shewanella oneidensis strain MR-1, from China Center of Industrial Culture Collection, CICC.</p><br />
<p>&nbsp;</p><br />
<p>Luria-Bertani (LB) broth was inoculated with S. oneidensis strain MR-1 and incubated aerobically at 30 &deg;C for 5 days with shaking at 200 rpm. After assembling the MFC (described below) devices, 2 mL of MR-1 culture was transferred to a sterile MFC anode chamber, as well as 28ml sterile anode medium and lactate was added (20 mM) to ensure excess electron donor. Anode medium contained (per liter): 0.46 g NH4Cl, 0.225 g K2HPO4, 0.225 g KH2PO4, 0.117 g MgSO47H2O, 0.225 (NH4)2SO4, plus 10 ml of a mineral mix (containing per liter: 0.1 g MnCl24H2O, 0.3 g FeSO47H2O, 0.17 g CoCl26H2O, 0.1 g ZnCl2, 0.04 g CuSO45H2O, 0.005 g AlK(SO4)212H2O, 0.005 g H3BO3,0.09gNa2MoO4, 0.12 g NiCl2, 0.02 g NaWO42H2O, and 0.10 g Na2SeO4). Medium was adjusted to pH 7, sparged with oxygen-free N2, anode was sealed with white latex gasket.</p><br />
<p>&nbsp;</p><br />
<div></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;REFERENCE</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p><a name="_ENREF_1" id="_ENREF_1">Du, Z., Li, H., &amp; Gu, T. (2007). A state of the art review on microbial fuel cells: A promising technology for wastewater treatment and bioenergy. <em>Biotechnol Adv, 25</em>(5), 464-482. doi: 10.1016/j.biotechadv.2007.05.004</a> <br /><br />
<a name="_ENREF_2" id="_ENREF_2">Gorby, Y. A., Yanina, S., McLean, J. S., Rosso, K. M., Moyles, D., Dohnalkova, A., . . . Fredrickson, J. K. (2006). Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms. <em>Proc Natl Acad Sci U S A, 103</em>(30), 11358-11363. doi: 10.1073/pnas.0604517103</a> <br /><br />
<a name="_ENREF_3" id="_ENREF_3">Logan, B., Cheng, S., Watson, V., &amp; Estadt, G. (2007). Graphite fiber brush anodes for increased power production in air-cathode microbial fuel cells. <em>Environ Sci Technol, 41</em>(9), 3341-3346. </a> <br /><br />
<a name="_ENREF_4" id="_ENREF_4">Marsili, E., Baron, D. B., Shikhare, I. D., Coursolle, D., Gralnick, J. A., &amp; Bond, D. R. (2008). Shewanella secretes flavins that mediate extracellular electron transfer. <em>Proc Natl Acad Sci U S A, 105</em>(10), 3968-3973. doi: 10.1073/pnas.0710525105</a> <br /><br />
<a name="_ENREF_5" id="_ENREF_5">Rabaey, K., &amp; Verstraete, W. (2005). Microbial fuel cells: novel biotechnology for energy generation. <em>Trends Biotechnol, 23</em>(6), 291-298. doi: 10.1016/j.tibtech.2005.04.008</a></p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab4
Team:LZU-China/wetlab4
2014-10-17T19:17:31Z
<p>Lzuzx: Created page with "<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns=" http://www.w3.org/1999/xhtml"> <head> <me..."</p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:4677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:3200px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3931px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="75%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="50">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;DESIGN AND CREATE MFC DEVICES</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p><strong>MFC Assembly and Operation.</strong></p><br />
<p>&nbsp;</p><br />
<p>Generally speaking a MFC has two electrodes, an anode and a cathode, a proton exchange membrane and a circuit pathway linking the two electrodes for the electron transfer from anode to cathode. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/47/MFC_sketch.png" width="555" height="479" /></p><br />
<p>Figure-11. Schematic diagram of a typical two-chamber microbial fuel cell(<a href="#_ENREF_1" title="Du, 2007 #10">Du et al., 2007</a>) </p><br />
<p>&nbsp;</p><br />
<p>The catholyte in all experiments was an unstirred 50 mM potassium ferricyanide solution in 100 mM phosphate buffer (pH=7.4), which was continuously open to air. The MFC design with carbon brush electrodes is shown in Figure 12. Brush anodes were made of carbon fibers (Haoshi carbon fiber, Lanzhou, Gansu, China) cut to a 3cm length and wound using a simple brush manufacturing system into a twisted core consisting of two titanium wires.</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/d/d5/MFC_components.png" alt="" width="455" height="340" /></div><br />
<p>&nbsp;</p><br />
<p>Figure-12. Components of MFC devices we previously used.</p><br />
<p>&nbsp;</p><br />
<div><br />
<p>&nbsp;</p><br />
<p>We designed a kind of cube-like two chamber MFC device, reference others&rsquo; single-chamber researches(<a href="#_ENREF_3" title="Logan, 2007 #76">Logan, Cheng, Watson, &amp; Estadt, 2007</a>). The cube was like a symmetrical 5&times;5&times;5cm polymethyl methacrylate cube, each chamber has two hole to aerate or load medium, each cylindrical chamber has 30ml with 4cm diameter, the blue print was shown in figure 13 . The white latex rubber gaskets were applied between every component of MFC devices to seal (figure 14).</p><br />
</div><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/1/1e/AutoCAD_MFC.png" alt="" width="455" height="340" /></div><br />
<p>&nbsp;</p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure 13. Blue print (3 views) of one MFC component design.</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/5/5b/MFC_crystal.png" alt="" width="455" height="340" /><br clear="all" /><br />
Figure-14. A blank MFC device without carbon brush.</div><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Microbiological Methods<br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;It&rsquo;s reported that Shewanella, a well-known star of electricity-producing bacteria family, can secretes riboflavin that mediate extracellular electron transfer (<a href="#_ENREF_4" title="Marsili, 2008 #75">Marsili et al., 2008</a>) , additionally, this amazing bacteria can produce electrically conductive pilus-like appendages called directly transfer electric charge by touching relative remote anode material(<a href="#_ENREF_2" title="Gorby, 2006 #49">Gorby et al., 2006</a>) . So we buy standard bacteria strain, Shewanella oneidensis strain MR-1, from China Center of Industrial Culture Collection, CICC.</p><br />
<p>&nbsp;</p><br />
<p>Luria-Bertani (LB) broth was inoculated with S. oneidensis strain MR-1 and incubated aerobically at 30 &deg;C for 5 days with shaking at 200 rpm. After assembling the MFC (described below) devices, 2 mL of MR-1 culture was transferred to a sterile MFC anode chamber, as well as 28ml sterile anode medium and lactate was added (20 mM) to ensure excess electron donor. Anode medium contained (per liter): 0.46 g NH4Cl, 0.225 g K2HPO4, 0.225 g KH2PO4, 0.117 g MgSO47H2O, 0.225 (NH4)2SO4, plus 10 ml of a mineral mix (containing per liter: 0.1 g MnCl24H2O, 0.3 g FeSO47H2O, 0.17 g CoCl26H2O, 0.1 g ZnCl2, 0.04 g CuSO45H2O, 0.005 g AlK(SO4)212H2O, 0.005 g H3BO3,0.09gNa2MoO4, 0.12 g NiCl2, 0.02 g NaWO42H2O, and 0.10 g Na2SeO4). Medium was adjusted to pH 7, sparged with oxygen-free N2, anode was sealed with white latex gasket.</p><br />
<p>&nbsp;</p><br />
<div></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;REFERENCE</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p><a name="_ENREF_1" id="_ENREF_1">Du, Z., Li, H., &amp; Gu, T. (2007). A state of the art review on microbial fuel cells: A promising technology for wastewater treatment and bioenergy. <em>Biotechnol Adv, 25</em>(5), 464-482. doi: 10.1016/j.biotechadv.2007.05.004</a> <br /><br />
<a name="_ENREF_2" id="_ENREF_2">Gorby, Y. A., Yanina, S., McLean, J. S., Rosso, K. M., Moyles, D., Dohnalkova, A., . . . Fredrickson, J. K. (2006). Electrically conductive bacterial nanowires produced by Shewanella oneidensis strain MR-1 and other microorganisms. <em>Proc Natl Acad Sci U S A, 103</em>(30), 11358-11363. doi: 10.1073/pnas.0604517103</a> <br /><br />
<a name="_ENREF_3" id="_ENREF_3">Logan, B., Cheng, S., Watson, V., &amp; Estadt, G. (2007). Graphite fiber brush anodes for increased power production in air-cathode microbial fuel cells. <em>Environ Sci Technol, 41</em>(9), 3341-3346. </a> <br /><br />
<a name="_ENREF_4" id="_ENREF_4">Marsili, E., Baron, D. B., Shikhare, I. D., Coursolle, D., Gralnick, J. A., &amp; Bond, D. R. (2008). Shewanella secretes flavins that mediate extracellular electron transfer. <em>Proc Natl Acad Sci U S A, 105</em>(10), 3968-3973. doi: 10.1073/pnas.0710525105</a> <br /><br />
<a name="_ENREF_5" id="_ENREF_5">Rabaey, K., &amp; Verstraete, W. (2005). Microbial fuel cells: novel biotechnology for energy generation. <em>Trends Biotechnol, 23</em>(6), 291-298. doi: 10.1016/j.tibtech.2005.04.008</a></p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab3
Team:LZU-China/wetlab3
2014-10-17T19:15:13Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5588px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 80px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:5477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:2900px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3731px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="75%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="40"><strong> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong></strong>PNP PROMOTE THE RIBOFLAVIN'S EXPRESS </strong></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong>Genetically modified E.coli was able to produce quantitative riboflavin dependent on substrate&rsquo;s concentration.</strong></p><br />
<p>Using a pollutant substrate bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli with plasmid pET28A can secrete riboflavin when we add PNP in medium.</p><br />
<p>&nbsp;</p><br />
<p>The E.coli was incubate with LB broth overnight at 37℃,200rpm and feed with quantitative PNP and incubate for another 12 hours fermentation. Supernatant was collected by centrifuge at 4000&times;g and adjusted pH to 3~4 in order to eliminate the PNP&rsquo;s absorb of blue light, which may disorder the measurement of riboflavin. Supernatant was transferred to spectrophotometer and measured absorb value at 444nm. E.coli strain DH5&alpha;fermented LB broth was treated by same method above as the control group set at 0 absorption value. A riboflavin standard curve was established for quantitatively measurement (figure 6). </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/f/fb/Rib_curve.png" width="540" height="345" /></p><br />
<p>Figure-6. Riboflavin OD value standard curve at 444nm.</p><br />
<p>&nbsp;</p><br />
<p><strong>E.coli SUPER SEVEN</strong>!<br /><br />
We test many single colonies of genetically modified E.coli and screen their riboflavin production at same condition, then we get the most efficiency bacteria strain&mdash;Super Seven&mdash;as our seed bacteria. As shown in figure6, when treated with concentration gradient of PNP, Super Seven was able to secrete a stabilized and quantitatively amount of riboflavin. PNP, a toxic industrial pollutant could influence the microorganism&rsquo;s metabolism and growth, so that curve goes down when PNP addition is high. <br /><br />
</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/b/b0/PNP-Riboflavin.png" alt="" width="572" height="428" align="middle" /></p><br />
<p>Figure-7. Concentration of riboflavin secreted by Super Seven treated with different amount of PNP.</p><br />
<p>&nbsp;</p><br />
<p>We used Gauss function to fit that curve, it&rsquo;s a good mathematics model so far (figure 8).</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/2/20/GaussAmp_Fit.png" alt="" width="455" height="340" /></p><br />
<p>&nbsp;Figure-8. A Gauss function was built to fit curve in figure 7, the formula of this curve is <br /><br />
y=0.4186 + (0.96352/(0.369*SQRT(3.1416/2)))*EXP(-2*((x-0.44771)/0.369)^2) </p><br />
<p>and the adjusted R-square value is 0.929. </p><br />
<p>&nbsp;</p><br />
<div></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong>Riboflavin can stimulate the MFC power output.</strong></td><br />
</tr><br />
</table><br />
</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="670">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;When E.coli Super Seven secrete riboflavin to the anode medium or add riboflavin manually, the MFC system will have a better performance. The riboflavin is a kind of redox mediator; it could enhance the MFC power output in a great scale in just a few minute (figure 8).</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/36/Rib-power.png" alt="" width="455" height="340" /></div><br />
<p>&nbsp;</p><br />
<p>Figure-9. Gradient concentrations of riboflavin could raise the MFC voltage, measured with 200&Omega; external resistance,peak voltages were recorded within 5 hours after riboflavin added.</p><br />
<p>&nbsp;</p><br />
<div></div><br />
<p>We found that the most important dependent variable was not the power density or peak voltage as we think previously, instead, voltage increment value reflect riboflavin&rsquo;s concentration best. Another fact was that the voltage increments were often dependent on former power output.</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong>Measure PNP concentrations with MFC system</strong></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p><strong>Measure PNP concentrations with a PNP bio-sensor coupling riboflavin MFC stimulate system.</strong> </p><br />
<p>&nbsp;</p><br />
<p>We tried to make E.coli Super Seven co-exist with Shewanella in anode medium at the same time. When PNP pollutant was added, Super Seven could secrete riboflavin; as a result, MFC voltage would rise and reflect the PNP concentrations. Though riboflavin&rsquo;s expression quantity was relative low as the iGEM authority plasmid pSB1C3 is not the best expression vector, we still found the interrelationship between PNP addition and voltage increment. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/f/f5/Final_data.png" alt="" width="800" height="600" /></p><br />
<p>Figure-10. Using MFC devices measuring concentrations of PNP obtained a fitting curve.</p><br />
<p>&nbsp;</p><br />
<p>We introduced<em>(</em><em>&Delta;</em><em>E)</em> as dependent variable, PNP concentration is independent variable and the previous stable voltage of MFC without pollutant treatment, E1, is an important parameter in this interrelationship. We also created a constant value, which dependent on our novel MFC devices and experimental data.</p><br />
<p>&nbsp;</p><br />
<p> We conclude an empirical formula for our devices:</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/cf/Formula.png" alt="" width="513" height="90" /></p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p>In our experiments with MFC devices designed by ourselves, the MFC Characteristic Constant is a certain value, C=1.4034.</p><br />
We can measure the voltage value,<em>&Delta;E</em>, and deduce the PNP pollutant concentration, vice versa.<br />
<br />
<p align="left">&nbsp;</p><br />
<p align="left"></p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/06/L5.png" width="349" height="81" /></a></p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab3
Team:LZU-China/wetlab3
2014-10-17T19:14:38Z
<p>Lzuzx: Created page with "<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns=" http://www.w3.org/1999/xhtml"> <head> <me..."</p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:5588px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 80px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:5477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:2900px;<br />
width:100%;<br />
height:1px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3731px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="18%">&nbsp;</td><br />
<td width="64%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="18%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="40"><strong> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong></strong>PNP PROMOTE THE RIBOFLAVIN'S EXPRESS </strong></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong>Genetically modified E.coli was able to produce quantitative riboflavin dependent on substrate&rsquo;s concentration.</strong></p><br />
<p>Using a pollutant substrate bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli with plasmid pET28A can secrete riboflavin when we add PNP in medium.</p><br />
<p>&nbsp;</p><br />
<p>The E.coli was incubate with LB broth overnight at 37℃,200rpm and feed with quantitative PNP and incubate for another 12 hours fermentation. Supernatant was collected by centrifuge at 4000&times;g and adjusted pH to 3~4 in order to eliminate the PNP&rsquo;s absorb of blue light, which may disorder the measurement of riboflavin. Supernatant was transferred to spectrophotometer and measured absorb value at 444nm. E.coli strain DH5&alpha;fermented LB broth was treated by same method above as the control group set at 0 absorption value. A riboflavin standard curve was established for quantitatively measurement (figure 6). </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/f/fb/Rib_curve.png" width="540" height="345" /></p><br />
<p>Figure-6. Riboflavin OD value standard curve at 444nm.</p><br />
<p>&nbsp;</p><br />
<p><strong>E.coli SUPER SEVEN</strong>!<br /><br />
We test many single colonies of genetically modified E.coli and screen their riboflavin production at same condition, then we get the most efficiency bacteria strain&mdash;Super Seven&mdash;as our seed bacteria. As shown in figure6, when treated with concentration gradient of PNP, Super Seven was able to secrete a stabilized and quantitatively amount of riboflavin. PNP, a toxic industrial pollutant could influence the microorganism&rsquo;s metabolism and growth, so that curve goes down when PNP addition is high. <br /><br />
</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/b/b0/PNP-Riboflavin.png" alt="" width="572" height="428" align="middle" /></p><br />
<p>Figure-7. Concentration of riboflavin secreted by Super Seven treated with different amount of PNP.</p><br />
<p>&nbsp;</p><br />
<p>We used Gauss function to fit that curve, it&rsquo;s a good mathematics model so far (figure 8).</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/2/20/GaussAmp_Fit.png" alt="" width="455" height="340" /></p><br />
<p>&nbsp;Figure-8. A Gauss function was built to fit curve in figure 7, the formula of this curve is <br /><br />
y=0.4186 + (0.96352/(0.369*SQRT(3.1416/2)))*EXP(-2*((x-0.44771)/0.369)^2) </p><br />
<p>and the adjusted R-square value is 0.929. </p><br />
<p>&nbsp;</p><br />
<div></div><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong>Riboflavin can stimulate the MFC power output.</strong></td><br />
</tr><br />
</table><br />
</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%" height="670">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;When E.coli Super Seven secrete riboflavin to the anode medium or add riboflavin manually, the MFC system will have a better performance. The riboflavin is a kind of redox mediator; it could enhance the MFC power output in a great scale in just a few minute (figure 8).</p><br />
<p>&nbsp;</p><br />
<div><img src="https://static.igem.org/mediawiki/2014/3/36/Rib-power.png" alt="" width="455" height="340" /></div><br />
<p>&nbsp;</p><br />
<p>Figure-9. Gradient concentrations of riboflavin could raise the MFC voltage, measured with 200&Omega; external resistance,peak voltages were recorded within 5 hours after riboflavin added.</p><br />
<p>&nbsp;</p><br />
<div></div><br />
<p>We found that the most important dependent variable was not the power density or peak voltage as we think previously, instead, voltage increment value reflect riboflavin&rsquo;s concentration best. Another fact was that the voltage increments were often dependent on former power output.</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">&nbsp;</td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<strong>Measure PNP concentrations with MFC system</strong></td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p><strong>Measure PNP concentrations with a PNP bio-sensor coupling riboflavin MFC stimulate system.</strong> </p><br />
<p>&nbsp;</p><br />
<p>We tried to make E.coli Super Seven co-exist with Shewanella in anode medium at the same time. When PNP pollutant was added, Super Seven could secrete riboflavin; as a result, MFC voltage would rise and reflect the PNP concentrations. Though riboflavin&rsquo;s expression quantity was relative low as the iGEM authority plasmid pSB1C3 is not the best expression vector, we still found the interrelationship between PNP addition and voltage increment. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/f/f5/Final_data.png" alt="" width="800" height="600" /></p><br />
<p>Figure-10. Using MFC devices measuring concentrations of PNP obtained a fitting curve.</p><br />
<p>&nbsp;</p><br />
<p>We introduced<em>(</em><em>&Delta;</em><em>E)</em> as dependent variable, PNP concentration is independent variable and the previous stable voltage of MFC without pollutant treatment, E1, is an important parameter in this interrelationship. We also created a constant value, which dependent on our novel MFC devices and experimental data.</p><br />
<p>&nbsp;</p><br />
<p> We conclude an empirical formula for our devices:</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/cf/Formula.png" alt="" width="513" height="90" /></p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p>In our experiments with MFC devices designed by ourselves, the MFC Characteristic Constant is a certain value, C=1.4034.</p><br />
We can measure the voltage value,<em>&Delta;E</em>, and deduce the PNP pollutant concentration, vice versa.<br />
<br />
<p align="left">&nbsp;</p><br />
<p align="left"></p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/06/L5.png" width="349" height="81" /></a></p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab2
Team:LZU-China/wetlab2
2014-10-17T19:11:56Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4588px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:4477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3431px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="75%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GENETIC ENGINEERED BACTERIA</div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We designed this pathway for our purpose. As you can see, the NsrR is constitutive expressed in almost all E. coli orgnisms and it can repress the promoter PyeaR. In our project we found that this sensitive system is also adjusted to the PNP(p-nitrophenol). So we constructed this sensor pathway.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The sensor will cause the expression of riboflavin, a kind of mediator which can induce the generation of current in MFCs, to show the appearance of PNP. We can estimate the concentration of PNP. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/ee/WETAimage001.png" width="800" height="467" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The pathway of PNP sensor</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Besides, we find many genes can catalyze the reduction of Cr(VI). They can be used in the cathode to reduce these heavy metal ions.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/3/39/WETAimage002.png" width="556" height="307" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-2 The pathway of the Cr ion reductase(yieF as an example)</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ABOUT THE CONSTRUCTION OF PNP SENSOR</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We found that the part BBa_K381001 by iGEM10_BCCS-Bristol is a sensor which can detect the appearance of nitrate and nitrite. So we perfomed an experience by this part to see if this part can detect PNP(p-Nitrophenol).<br />
We got a good result.You can see the PNP can also induce the green fluorescence.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/3/3c/Image005.png" width="455" height="340" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 Fluorescence of different system. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with ddH2O;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;c.bacterial liquid with 10mM KNO3;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;d.bacterial liquid with 10mM KCl.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Firstly we got the plasmid with K1172303 from Registry. We cut the plasmid by EcoRI and XbaI, then put the <em>Pnsr</em>(K216005+B0030 this sequence was synthesized by company) into the gap.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/0/06/Image008.jpg" width="489" height="90" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-4 Construction of K1523101</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5&rsquo;---TTCCCATCTATAATCCTCCCTGATTCTTCG---3&rsquo;;anti-sense:5&rsquo;---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3&rsquo;). From the gel picture we can see the size is right.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/c1/Image009.png" width="643" height="305" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-5 Gel picture of K1523101&rsquo;s PCR</p><br />
<p align="center">&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ABOUT THE REDUCING Cr IONS GENES</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We found four genes to reduce the Cr(VI) to Cr(III). They are<em> nahG, nahR, nahE, chrR</em> and <em>yieF. </em>We didn&rsquo;t do the deep research about them because of time limitation. They can be used in the general plasmids such as pBR322. We just made them to be the formation of Biobrick. More uses and functions need to be demonstrated and found.</p><br />
<p align="left"><strong><em>nahG</em></strong>: We got the sequence from <em>Pseudomonas putida</em> </p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;---CCGGAATTCGCGGCCGCTTCTAGATGAAAAACAATAAACCTGGCTTGCGC---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCACCCTTGACGTAGCACACC---3&rsquo;)<br /><br />
<strong><em>nahE: </em></strong>We got the sequence from <em>Pseudomonas putida<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;---CCGGAATTCGCGGCCGCTTCTAGATGTCGAATAAAATTATGAAAACGTCGCG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGCTACTTCAATTCATTACTGTATTTAGCGTG---3&rsquo;)<br /><br />
<strong><em>nahR: </em></strong>We got the sequence from <em>Pseudomonas putida<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- CCGGAATTCGCGGCCGCTTCTAGATGAAAAACAATAAACCTGGCTTGCGC---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCACCCTTGACGTAGCACACC---3&rsquo;)<br /><br />
<strong><em>chrR: </em></strong>We got the sequence from <em>Escherichia coli str. K-12<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- CCGGAATTCGCGGCCGCTTCTAGATGAAAAAAATAGTCCAGTCGGAAGG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCAGGCCTTTTTGTGCTGTTCAAC---3&rsquo;)<br /><br />
<strong><em>yieF: </em></strong>We got the sequence from <em>Escherichia coli str. K-12<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- GAATTCGGATCCATGTCTGAAAAATTGCAGGTGG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---GAATTCTCTAGATTAGATCTTAACTCGCTGAATAAA---3&rsquo;)</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/f/ff/L4.png" width="349" height="81" /></a></p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab2
Team:LZU-China/wetlab2
2014-10-17T19:11:00Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4588px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:4477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3431px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="75%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GENETIC ENGINEERED BACTERIA</div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We designed this pathway for our purpose. As you can see, the NsrR is constitutive expressed in almost all E. coli orgnisms and it can repress the promoter PyeaR. In our project we found that this sensitive system is also adjusted to the PNP(p-nitrophenol). So we constructed this sensor pathway.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The sensor will cause the expression of riboflavin, a kind of mediator which can induce the generation of current in MFCs, to show the appearance of PNP. We can estimate the concentration of PNP. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/ee/WETAimage001.png" width="800" height="467" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The pathway of PNP sensor</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Besides, we find many genes can catalyze the reduction of Cr(VI). They can be used in the cathode to reduce these heavy metal ions.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/3/39/WETAimage002.png" width="556" height="307" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-2 The pathway of the Cr ion reductase(yieF as an example)</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ABOUT THE CONSTRUCTION OF PNP SENSOR</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We found that the part BBa_K381001 by iGEM10_BCCS-Bristol is a sensor which can detect the appearance of nitrate and nitrite. So we perfomed an experience by this part to see if this part can detect PNP(p-Nitrophenol).<br />
We got a good result.You can see the PNP can also induce the green fluorescence.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/3/3c/Image005.png" width="455" height="340" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 Fluorescence of different system. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with ddH2O;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;c.bacterial liquid with 10mM KNO3;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;d.bacterial liquid with 10mM KCl.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Firstly we got the plasmid with K1172303 from Registry. We cut the plasmid by EcoRI and XbaI, then put the <em>Pnsr</em>(K216005+B0030 this sequence was synthesized by company) into the gap.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/0/06/Image008.jpg" width="489" height="90" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-4 Construction of K1523101</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5&rsquo;---TTCCCATCTATAATCCTCCCTGATTCTTCG---3&rsquo;;anti-sense:5&rsquo;---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3&rsquo;). From the gel picture we can see the size is right.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/c1/Image009.png" width="643" height="305" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-5 Gel picture of K1523101&rsquo;s PCR</p><br />
<p align="center">&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ABOUT THE REDUCING Cr IONS GENES</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We found four genes to reduce the Cr(VI) to Cr(III). They are<em> nahG, nahR, nahE, chrR</em> and <em>yieF. </em>We didn&rsquo;t do the deep research about them because of time limitation. They can be used in the general plasmids such as pBR322. We just made them to be the formation of Biobrick. More uses and functions need to be demonstrated and found.</p><br />
<p align="left"><strong><em>nahG</em></strong>: We got the sequence from <em>Pseudomonas putida</em> </p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;---CCGGAATTCGCGGCCGCTTCTAGATGAAAAACAATAAACCTGGCTTGCGC---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCACCCTTGACGTAGCACACC---3&rsquo;)<br /><br />
<strong><em>nahE: </em></strong>We got the sequence from <em>Pseudomonas putida<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;---CCGGAATTCGCGGCCGCTTCTAGATGTCGAATAAAATTATGAAAACGTCGCG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGCTACTTCAATTCATTACTGTATTTAGCGTG---3&rsquo;)<br /><br />
<strong><em>nahR: </em></strong>We got the sequence from <em>Pseudomonas putida<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- CCGGAATTCGCGGCCGCTTCTAGATGAAAAACAATAAACCTGGCTTGCGC---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCACCCTTGACGTAGCACACC---3&rsquo;)<br /><br />
<strong><em>chrR: </em></strong>We got the sequence from <em>Escherichia coli str. K-12<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- CCGGAATTCGCGGCCGCTTCTAGATGAAAAAAATAGTCCAGTCGGAAGG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCAGGCCTTTTTGTGCTGTTCAAC---3&rsquo;)<br /><br />
<strong><em>yieF: </em></strong>We got the sequence from <em>Escherichia coli str. K-12<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- GAATTCGGATCCATGTCTGAAAAATTGCAGGTGG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---GAATTCTCTAGATTAGATCTTAACTCGCTGAATAAA---3&rsquo;)</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/f/ff/L4.png" width="349" height="81" /></a></p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab2
Team:LZU-China/wetlab2
2014-10-17T19:10:13Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{border:0 none}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:4588px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 45px;<br />
color: #000;<br />
text-align: left;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 16px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:4477px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:1900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:3431px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="18%">&nbsp;</td><br />
<td width="64%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><a href="https://2014.igem.org/Team:LZU-China/wetlab"><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /></a><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="18%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<div> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;GENETIC ENGINEERED BACTERIA</div><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We designed this pathway for our purpose. As you can see, the NsrR is constitutive expressed in almost all E. coli orgnisms and it can repress the promoter PyeaR. In our project we found that this sensitive system is also adjusted to the PNP(p-nitrophenol). So we constructed this sensor pathway.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The sensor will cause the expression of riboflavin, a kind of mediator which can induce the generation of current in MFCs, to show the appearance of PNP. We can estimate the concentration of PNP. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/e/ee/WETAimage001.png" width="800" height="467" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-1 The pathway of PNP sensor</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Besides, we find many genes can catalyze the reduction of Cr(VI). They can be used in the cathode to reduce these heavy metal ions.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/3/39/WETAimage002.png" width="556" height="307" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-2 The pathway of the Cr ion reductase(yieF as an example)</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div id="apDiv8"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td ><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ABOUT THE CONSTRUCTION OF PNP SENSOR</div></td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="30%">&nbsp;</td><br />
<td ><p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We found that the part BBa_K381001 by iGEM10_BCCS-Bristol is a sensor which can detect the appearance of nitrate and nitrite. So we perfomed an experience by this part to see if this part can detect PNP(p-Nitrophenol).<br />
We got a good result.You can see the PNP can also induce the green fluorescence.</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/3/3c/Image005.png" width="455" height="340" /></p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-3 Fluorescence of different system. </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;a.bacterial liquid with 10mM PNP;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;b.bacterial liquid with ddH2O;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;c.bacterial liquid with 10mM KNO3;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;d.bacterial liquid with 10mM KCl.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Firstly we got the plasmid with K1172303 from Registry. We cut the plasmid by EcoRI and XbaI, then put the <em>Pnsr</em>(K216005+B0030 this sequence was synthesized by company) into the gap.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/0/06/Image008.jpg" width="489" height="90" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-4 Construction of K1523101</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;The size of the whole part is about 3700bp(without plasmid), we test the assembling result by PCR(sense:5&rsquo;---TTCCCATCTATAATCCTCCCTGATTCTTCG---3&rsquo;;anti-sense:5&rsquo;---GAATTCTCTAGATTACAACTGTTGTTCAAGCTGTT---3&rsquo;). From the gel picture we can see the size is right.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<img src="https://static.igem.org/mediawiki/2014/c/c1/Image009.png" width="643" height="305" /></p><br />
<p align="center">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Figure-5 Gel picture of K1523101&rsquo;s PCR</p><br />
<p align="center">&nbsp;</p></td><br />
<td width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
</div><br />
<div id="apDiv9"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg"><p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" ><div>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;ABOUT THE REDUCING Cr IONS GENES</div></td><br />
</tr><br />
</table><br />
<div></div><br />
<table width="100%" border="0" ><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%">&nbsp;</td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%"><p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We found four genes to reduce the Cr(VI) to Cr(III). They are<em> nahG, nahR, nahE, chrR</em> and <em>yieF. </em>We didn&rsquo;t do the deep research about them because of time limitation. They can be used in the general plasmids such as pBR322. We just made them to be the formation of Biobrick. More uses and functions need to be demonstrated and found.</p><br />
<p align="left"><strong><em>nahG</em></strong>: We got the sequence from <em>Pseudomonas putida</em> </p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;---CCGGAATTCGCGGCCGCTTCTAGATGAAAAACAATAAACCTGGCTTGCGC---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCACCCTTGACGTAGCACACC---3&rsquo;)<br /><br />
<strong><em>nahE: </em></strong>We got the sequence from <em>Pseudomonas putida<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;---CCGGAATTCGCGGCCGCTTCTAGATGTCGAATAAAATTATGAAAACGTCGCG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGCTACTTCAATTCATTACTGTATTTAGCGTG---3&rsquo;)<br /><br />
<strong><em>nahR: </em></strong>We got the sequence from <em>Pseudomonas putida<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- CCGGAATTCGCGGCCGCTTCTAGATGAAAAACAATAAACCTGGCTTGCGC---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCACCCTTGACGTAGCACACC---3&rsquo;)<br /><br />
<strong><em>chrR: </em></strong>We got the sequence from <em>Escherichia coli str. K-12<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- CCGGAATTCGCGGCCGCTTCTAGATGAAAAAAATAGTCCAGTCGGAAGG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---AAAATACTAGTAGCGGCCGCTGCAGTCAGGCCTTTTTGTGCTGTTCAAC---3&rsquo;)<br /><br />
<strong><em>yieF: </em></strong>We got the sequence from <em>Escherichia coli str. K-12<strong> </strong></em><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;(Primer:sense:5&rsquo;--- GAATTCGGATCCATGTCTGAAAAATTGCAGGTGG---3&rsquo;;<br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;anti-sense:5&rsquo;---GAATTCTCTAGATTAGATCTTAACTCGCTGAATAAA---3&rsquo;)</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/f/ff/L4.png" width="349" height="81" /></a></p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;</p><br />
<p align="left"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab
Team:LZU-China/wetlab
2014-10-17T19:06:15Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:4900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:7331px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="15%">&nbsp;</td><br />
<td width="75%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="50">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INTRODUCTION</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Why did we choose the MFC as our device? MFC is an abbreviation of microbial fuel cell.MFC is a bioreactor that can convert biomass energy into electricity through the metabolic activity of bacteria in the anode chamber.(<a href="#_ENREF_1" title="Du, 2007 #10">Du, Li, &amp; Gu, 2007</a>) . Nowadays, MFC is a new energy source available for us to solve pollution problem and produce electricity energy simultaneously. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/47/MFC_sketch.png" width="555" height="479" /></p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;However, the main challenge of MFC is how to bring these technologies out of the laboratory and engineer practical systems for bioenergy production at larger scales. One of the most severe problems is the low efficiency of extracellular electron transfer without the help of redox mediators added manually into the reactor, such as neutral red, thionin (<a href="#_ENREF_5" title="Rabaey, 2005 #50">Rabaey &amp; Verstraete, 2005</a>) . The addition of these mediators seemed to be another troublesome pollutant to deal with.<br /><br />
</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/1/1c/Duxuejing_cartoon_Bhalf.png" alt="" width="627" height="304" align="middle" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In our study, we successfully constructed a power stimulating model to solve this puzzle. We use <em>Shewanella</em>, a well-known star of electricity-producing bacteria family, as our devices&rsquo; powerful engine, it can send forth bacterial <em>nanowires and reach the highest power output peak</em>. Furthermore, we construct an extraordinary &ldquo;<em>Turbo Boost</em>&rdquo; device&mdash;genetically modified E.coli system&mdash;to stimulate this process. The hero of this story is riboflavin, a natural redox mediator also known as Vitamin B2. Our E.coli system can produce a certain amount of riboflavin, which concentration is dependent on substrate&rsquo;s quantity, using a pollutant substrate bio-sensor coupling riboflavin synthetic gene cluster. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/6/6e/Old_MFC_photo.png" alt="" width="455" height="340" /></p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In that system, we can monitor pollutant concentration real-timely by measuring the voltage of MFC devices and demonstrate result via data processing center and mobile network application.</p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/L3.png" alt="" width="349" height="81" /></a></p><br />
<p>&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab
Team:LZU-China/wetlab
2014-10-17T19:05:11Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:4900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:7331px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="10%">&nbsp;</td><br />
<td width="80%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="10%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="50">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INTRODUCTION</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Why did we choose the MFC as our device? MFC is an abbreviation of microbial fuel cell.MFC is a bioreactor that can convert biomass energy into electricity through the metabolic activity of bacteria in the anode chamber.(<a href="#_ENREF_1" title="Du, 2007 #10">Du, Li, &amp; Gu, 2007</a>) . Nowadays, MFC is a new energy source available for us to solve pollution problem and produce electricity energy simultaneously. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/47/MFC_sketch.png" width="555" height="479" /></p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;However, the main challenge of MFC is how to bring these technologies out of the laboratory and engineer practical systems for bioenergy production at larger scales. One of the most severe problems is the low efficiency of extracellular electron transfer without the help of redox mediators added manually into the reactor, such as neutral red, thionin (<a href="#_ENREF_5" title="Rabaey, 2005 #50">Rabaey &amp; Verstraete, 2005</a>) . The addition of these mediators seemed to be another troublesome pollutant to deal with.<br /><br />
</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/1/1c/Duxuejing_cartoon_Bhalf.png" alt="" width="627" height="304" align="middle" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In our study, we successfully constructed a power stimulating model to solve this puzzle. We use <em>Shewanella</em>, a well-known star of electricity-producing bacteria family, as our devices&rsquo; powerful engine, it can send forth bacterial <em>nanowires and reach the highest power output peak</em>. Furthermore, we construct an extraordinary &ldquo;<em>Turbo Boost</em>&rdquo; device&mdash;genetically modified E.coli system&mdash;to stimulate this process. The hero of this story is riboflavin, a natural redox mediator also known as Vitamin B2. Our E.coli system can produce a certain amount of riboflavin, which concentration is dependent on substrate&rsquo;s quantity, using a pollutant substrate bio-sensor coupling riboflavin synthetic gene cluster. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/6/6e/Old_MFC_photo.png" alt="" width="455" height="340" /></p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In that system, we can monitor pollutant concentration real-timely by measuring the voltage of MFC devices and demonstrate result via data processing center and mobile network application.</p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/L3.png" alt="" width="349" height="81" /></a></p><br />
<p>&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab
Team:LZU-China/wetlab
2014-10-17T19:04:02Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2788px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2677px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:4900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:7331px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="18%">&nbsp;</td><br />
<td width="64%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/40/Dht1_%281%29.jpg" width="238" height="75" /><a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/Dht1_(2).jpg" width="229" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab3"><img src="https://static.igem.org/mediawiki/2014/e/e8/Dht1_(3).jpg" width="204" height="75" /></a><a href="https://2014.igem.org/Team:LZU-China/wetlab4"><img src="https://static.igem.org/mediawiki/2014/0/02/Dht1_(4).jpg" width="299" height="75" /></a></p></td><br />
<td width="18%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="50">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INTRODUCTION</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Why did we choose the MFC as our device? MFC is an abbreviation of microbial fuel cell.MFC is a bioreactor that can convert biomass energy into electricity through the metabolic activity of bacteria in the anode chamber.(<a href="#_ENREF_1" title="Du, 2007 #10">Du, Li, &amp; Gu, 2007</a>) . Nowadays, MFC is a new energy source available for us to solve pollution problem and produce electricity energy simultaneously. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/47/MFC_sketch.png" width="555" height="479" /></p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;However, the main challenge of MFC is how to bring these technologies out of the laboratory and engineer practical systems for bioenergy production at larger scales. One of the most severe problems is the low efficiency of extracellular electron transfer without the help of redox mediators added manually into the reactor, such as neutral red, thionin (<a href="#_ENREF_5" title="Rabaey, 2005 #50">Rabaey &amp; Verstraete, 2005</a>) . The addition of these mediators seemed to be another troublesome pollutant to deal with.<br /><br />
</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/1/1c/Duxuejing_cartoon_Bhalf.png" alt="" width="627" height="304" align="middle" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In our study, we successfully constructed a power stimulating model to solve this puzzle. We use <em>Shewanella</em>, a well-known star of electricity-producing bacteria family, as our devices&rsquo; powerful engine, it can send forth bacterial <em>nanowires and reach the highest power output peak</em>. Furthermore, we construct an extraordinary &ldquo;<em>Turbo Boost</em>&rdquo; device&mdash;genetically modified E.coli system&mdash;to stimulate this process. The hero of this story is riboflavin, a natural redox mediator also known as Vitamin B2. Our E.coli system can produce a certain amount of riboflavin, which concentration is dependent on substrate&rsquo;s quantity, using a pollutant substrate bio-sensor coupling riboflavin synthetic gene cluster. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/6/6e/Old_MFC_photo.png" alt="" width="455" height="340" /></p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In that system, we can monitor pollutant concentration real-timely by measuring the voltage of MFC devices and demonstrate result via data processing center and mobile network application.</p><br />
<div></div><br />
<p align="left">&nbsp;</p><br />
<p align="left">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<a href="https://2014.igem.org/Team:LZU-China/wetlab2"><img src="https://static.igem.org/mediawiki/2014/2/2c/L3.png" alt="" width="349" height="81" /></a></p><br />
<p>&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx
http://2014.igem.org/Team:LZU-China/wetlab
Team:LZU-China/wetlab
2014-10-17T18:23:27Z
<p>Lzuzx: </p>
<hr />
<div><!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" " http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><br />
<html xmlns=" http://www.w3.org/1999/xhtml"><br />
<head><br />
<meta http-equiv="Content-Type" content="text/html; charset=gb2312" /><br />
<title>LZU-China 2014</title><br />
<style type="text/css"><br />
<br />
<br />
<br />
<br />
#contentSub, #footer-box, #catlinks, #search-controls, #p-logo, .printfooter, .visualClear {display: none;} /*-- hides default wiki settings --*/<br />
<br />
.firstHeading {<br />
width: 975px; <br />
margin: 0px auto;<br />
padding-top: 100px;<br />
margin-bottom: 20px;<br />
font-family: Georgia, Times, "Times New Roman", serif; <br />
}<br />
<br />
h1, h2, h3, h4, h5 { font-family: Georgia, Times, "Times New Roman", serif;}<br />
<br />
#top-section { /*-- styling for default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
border: 0 none;<br />
height: 14px;<br />
z-index: 100;<br />
top: 0;<br />
position: fixed;<br />
width: 975px; <br />
left: 50%; <br />
margin-left: -487px;<br />
}<br />
<br />
#top-section-bar { /*-- styling full width bar which hides behind default menu bar (edit, page, history, etc.) --*/<br />
background-color: #383838;<br />
height: 14px;<br />
display: block;<br />
z-index: 10;<br />
position: fixed;<br />
width: 100%;<br />
top: 0;<br />
}<br />
<br />
#menubar a:link, #menubar a:active, #menubar a:visited, #menubar a:hover, #menubar:hover { /*-- styling for default menu bar links (edit, page, history, etc.) --*/<br />
color: #727272; <br />
text-decoration: none; <br />
background-color: transparent;<br />
}<br />
<br />
body { <br />
background-color: #fff;<br />
}<br />
<br />
#globalWrapper, #content { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%;<br />
border: 0px;<br />
background-color: transparent;<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
html, body, .wrapper { /*-- changes default wiki settings --*/<br />
width: 100%; <br />
height: 100%; <br />
background-color: transparent; <br />
}<br />
<br />
#contentcontainer { /*-- creates container for all content on page --*/<br />
font-family: Arial, Helvetica, sans-serif; <br />
font-weight: normal; <br />
font-size: 14px; <br />
color: #414141;<br />
width: 960px; <br />
margin-left: auto; <br />
margin-right: auto; <br />
background-color: #transparent; <br />
margin-top: 0px; <br />
}<br />
<br />
.sidemenu, .sidemenu li { <br />
list-style-type: none; <br />
list-style-image: none; <br />
font-family: verdana; <br />
text-decoration: none; <br />
color:#000; <br />
font-size: 14px;<br />
}<br />
<br />
.sidemenu li {display: block;}<br />
<br />
.sidemenu a {<br />
text-decoration:none; <br />
color: #000;<br />
display: block; <br />
width: 180px; <br />
height: 100%; <br />
padding: 3px 5px; <br />
transition: .25s ease-in-out;<br />
-moz-transition: .25s ease-in-out;<br />
-webkit-transition: .25s ease-in-out;<br />
} <br />
<br />
.sidemenu a.greyout { color: #909090; }<br />
<br />
.sidemenu a:hover {<br />
color:#666; <br />
background-color: #d9f5aa;<br />
}<br />
<br />
.sub-sidemenu {font-size: 10px; margin-bottom: 20px; color: #666; display: none;}<br />
.sub-sidemenu a {color: #666;}<br />
<br />
div.underconst<br />
{<br />
padding:10px;<br />
border-radius:5px;<br />
background-color:pink;<br />
text-align:center;<br />
}<br />
<br />
a.anchor{display: block; position: relative; top: -80px; visibility: hidden;}<br />
<br />
.contentpara {margin-bottom: 30px;}<br />
<br />
span.email{font-family: monospace; font-weight: normal;}<br />
<br />
fieldset {border: 1px solid #337f53;}<br />
<br />
.greyout {color: #A0A0A0;}<br />
.highlightme {background-color: #FFFF00;}<br />
<br />
#alertContainer {border: 2px solid red; margin-bottom: 10px; width: 936px;}<br />
#annContainer {margin-left: 8px;}<br />
#newsContainer {border: 1px solid #ccc;}<br />
<br />
.newsTitle {<br />
display: block; <br />
color: #414141;<br />
font-size: 25px; <br />
font-family: Georgia, Times, "Times New Roman", serif;<br />
padding: 10px 15px 5px 10px; <br />
border-bottom: 1px solid #ccc; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem {<br />
border-bottom: 1px solid #ccc; <br />
display: block; <br />
padding: 5px 15px 0px 10px; <br />
margin-bottom: 0px; <br />
}<br />
<br />
.newsItem h3 {<br />
width: auto; <br />
display: inline; <br />
font-size: 14px; <br />
font-family: Arial, Helvetica, sans-serif; <br />
padding: 0px; <br />
margin: 0px;<br />
}<br />
<br />
.newsItem img {<br />
float: right; <br />
clear: right; <br />
width: 80px; <br />
padding-left: 15px;<br />
display: inline-block; <br />
}<br />
<br />
.newsItem .newsDate {<br />
font-style: italic; <br />
font-size: 14px; <br />
display: inline-block; <br />
color: #999; <br />
float: right; <br />
padding: 0px 0px 10px 15px;<br />
}<br />
<br />
.newsItem p, .newsItem ul, .newsItem li {<br />
padding: 0px; <br />
margin-left: 20px; <br />
font-size: 12px; <br />
line-height: 1.2;<br />
}<br />
<br />
.newsItem p {margin-top: 10px;}<br />
<br />
.annItem {<br />
border: 2px solid #49b677; <br />
display: block; <br />
padding: 0px 15px 10px 10px; <br />
margin-bottom: 18px; <br />
position: relative; <br />
height: 160px; <br />
vertical-align: middle;<br />
}<br />
<br />
.annItem .annCentered {<br />
display: table-cell; <br />
vertical-align: middle; <br />
height: 160px;<br />
}<br />
<br />
.annCentered h3 {<br />
padding: 0px;<br />
display: block; <br />
margin-left: auto; <br />
margin-right: auto; <br />
text-align: center;<br />
}<br />
<br />
.annItem ul, .annItem li {padding: 0px; margin: 0px;}<br />
.annItem li {list-style: none; margin: 5px}<br />
<br />
@charset "utf-8";<br />
body,h1,h2,h3,h4,h5,h6,hr,p,blockquote,dl,dt,dd,ul,ol,li,pre,form,fieldset,legend,button,input,textarea,th,td,figure{<br />
margin:0;<br />
padding:0;<br />
font-size: 14px;<br />
text-align: left;<br />
}<br />
html{background-color:#e9ecec}<br />
table{table-layout:fixed;border-collapse:collapse}<br />
section,article,aside,header,footer,nav,dialog,figure{display:block}<br />
.clearfix:after{content:"\20";display:block;height:0;line-height:0;font-size:0;clear:both}<br />
body,button,input,select,textarea,td,th{color:#333;font:12px/1.5 tahoma,arial,\5b8b\4f53}<br />
h1,h2,h3,h4,h5,h6{font-size:100%}<br />
address,cite,dfn,em,var{font-style:normal}<br />
code,kbd,pre,samp{font-family:courier new,courier,monospace}<br />
small{font-size:12px}ul,ol{list-style:none}a{text-decoration:none;color:#06C}<br />
a:hover{text-decoration:underline;color:#06C}<br />
sup{vertical-align:text-top}<br />
sub{vertical-align:text-bottom}<br />
legend{color:#000}<br />
fieldset,img{<br />
border:0 none;<br />
font-size: 15px;<br />
}<br />
button,input,select,textarea{font-size:100%}<br />
table{<br />
border-collapse:collapse;<br />
border-spacing:0;<br />
text-align: center;<br />
}<br />
input:focus{outline:none}<br />
.hd-main{height:60px;background:#fff;z-index:15;border-bottom:#b3b3b3 1px solid;box-shadow:0 0 5px #333}<br />
.f-icon{background-image:url('http://www.codefans.net/jscss/demoimg/201403//frame-icon.png');background-repeat:no-repeat}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .has-pulldown{cursor:pointer;position:relative;*z-index:10000}<br />
.hd-main .pulldown{position:absolute;cursor:default;display:none;top:30px;left:0}<br />
.hd-main .pulldown .arrow{*margin-bottom:-1px;_margin-bottom:0;height:0;width:0;font-size:0;line-height:0;border-width:7px;border-style:solid;border-color:transparent transparent rgba(255, 255, 255,0.8) transparent;_filter:chroma(color=tomato);_border-color:tomato tomato rgba(255, 255, 255,0.8) tomato;position:relative;display:block;left:20px;z-index:7}<br />
.hd-main .pulldown .content{background:rgba(255, 255, 255,0.8);color:#333;text-align:left;border-radius:3px;border:rgb(175,175,175) 1px solid;border-width:0 1px 1px 1px;box-shadow:0 2px 4px rgba(0,0,0,.2);position:relative;z-index:6}<br />
.hd-main .pulldown-canvas{position:absolute;top:0;left:0;width:100%;height:100%;opacity:0;filter:alpha(opacity=0)}<br />
.hd-main .logo{background-image:url('https://static.igem.org/mediawiki/2014/7/72/2014logomin.png');background-repeat:no-repeat;display:block;height:36px;width:175px;float:left;margin-left:10px;background-position:0 0;margin-top:5px;display:inline}<br />
.hd-main .navs{padding:0 0 3px 25px;height:45px;float:left}<br />
.hd-main .navs a,.hd-main .info a,.hd-main .navs a:visited,.hd-main .info a:visited,.hd-main .navs a:active,.hd-main .info a:active{color:#d8d8d8}<br />
.hd-main .navs a:hover,.hd-main .navs a:active{text-decoration:none;background-color:#0f0f0f}<br />
.hd-main .navs .def-nav,.hd-main .navs .pulldown-nav,.hd-main .navs .separate{display:block;float:left;height:48px;font:18px/30px "Microsoft YaHei","Microsoft JhengHei";color:#d8d8d8;text-align:center;width:125px;line-height:48px}<br />
.hd-main .navs .def-nav .app-url{left:185px;width:425px;top:48px}<br />
.hd-main .navs .def-nav .pulldown-canvas-url{width:575px;height:109px}<br />
.hd-main .navs .def-nav .app-url .arrow{left:140px}<br />
.hd-main .navs .app-url .content{padding:17px 0 0 22px;height:91px}<br />
.hd-main .navs .app-url .content a,.hd-main .navs .app-url .content a:hover{color:#333}<br />
.hd-main .navs .app-url .li{cursor:pointer;padding-top:8px;width:66px;height:66px;border-radius:3px;display:block;float:left;text-align:center}<br />
.hd-main .navs .app-url .li:hover{background-color:#e0e1e5}<br />
.hd-main .navs .app-url .li .icon{margin:0 auto;width:50px;height:50px;display:block;background:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png') no-repeat}<br />
.hd-main .navs .app-url .li:hover .icon{background-image:url('https://static.igem.org/mediawiki/2014/9/94/Icons50X50nb.png')}<br />
.hd-main .navs .app-url .tongxunlu .icon{background-position:-50px 0}<br />
.hd-main .navs .app-url .xiangce .icon{background-position:-100px 0}<br />
.hd-main .navs .app-url .note .icon{background-position:-150px 0}<br />
.hd-main .navs .app-url .duanxin .icon{background-position:-200px 0}<br />
.hd-main .navs .app-url .zhaohui .icon{background-position:-250px 0}<br />
.hd-main .navs .app-url .youxi .icon{background-position:-300px 0}<br />
.hd-main .navs .app-url .li .text{height:30px;display:block;font:10px/30px "Microsoft YaHei","Microsoft JhengHei"}<br />
.hd-main .navs .separate{margin:0;height:48px;width:2px;background:#2A2B2D}<br />
.hd-main .navs .pulldown-nav{position:relative}<br />
.hd-main .navs .pulldown-nav em{<br />
position:absolute;<br />
display:block;<br />
left:99px;<br />
top:18px;<br />
height:12px;<br />
width:12px;<br />
font-size:0;<br />
background-position:-89px -45px<br />
}<br />
.hd-main .navs .pulldown-nav:hover .f-icon,.hd-main .navs .pulldown-nav:active .f-icon{position:absolute;display:block;right:11px;top:18px;height:12px;width:12px;font-size:0;background-position:-89px -55px}<br />
.hd-main .navs .current,.hd-main .navs .current .pulldown-nav{font-weight:bold;color:#FFF;display:inline-block;width:125px;height:49px;background-color:#0f0f0f;text-align:center;line-height:48px}<br />
.hd-main .navs .current:hover{color:#ECECEC}<br />
.hd-main .navs .current .hover{background-color:#dedede;color:#333;}<br />
.hd-main .info,.hd-main .info ul{height:36px;float:right;text-align:right;margin-top:3px;white-space:nowrap}<br />
.hd-main .info a{color:#d8d8d8}<br />
.hd-main .info a:hover{color:#FFF;text-decoration:underline}<br />
.hd-main .info .info-i{padding:0 10px;margin:10px 0;display:inline-block;*display:inline;*zoom:1;height:16px;border-right:#393939 1px solid;color:#d8d8d8;font:12px/16px "SimSun"}<br />
.hd-main{padding:0 5px;height:49px;min-width:800px;background:#252525;border-bottom:0}<br />
.hd-main .info .has-pulldown{padding-right:28px}<br />
.hd-main .info .has-pulldown .pull-arrow{position:absolute;display:block;right:10px;top:1px;height:12px;width:12px;font-size:0;background-position:-89px -45px}<br />
.hd-main .info .no-separate{border:none}<br />
.hd-main .info .user-name{position:relative;padding-left:24px}<br />
.hd-main .info .user-name .name{display:inline-block;display:inline\0;white-space:nowrap;max-width:75px;overflow:hidden;text-overflow:ellipsis;vertical-align:bottom}<br />
.hd-main .info .user-name .identity{position:absolute;top:0;left:0;height:16px;width:16px;background-position:-89px -88px}<br />
.hd-main .info .user-name .is-vip{background-position:-89px -68px}<br />
.hd-main .info .user-info,.hd-main .info .more-info{top:9px;left:auto;right:-24px;width:170px} /*User栏目宽度*/<br />
.hd-main .info .notice-nu{display:inline-block;padding-left:4px;background-position:-86px -109px;height:14px;-webkit-text-size-adjust:none;font-size:10px;font-style:normal}<br />
.hd-main .info .notice-nu .f-icon{display:inline-block;padding-right:4px;background-position:right -109px;color:#FFF} /*此处原为#FFF*/<br />
.hd-main .info .user-info .arrow{left:70px;*left:-32px}<br />
.hd-main .info .user-info .content,.hd-main .info .more-info .content{padding:10px 0;height:180px}<br />
.hd-main .info .more{padding:0;display:inline;line-height:inherit;background:none}<br />
.hd-main .info .more-info .content{height:150px}<br />
.hd-main .info .user-info .content a,.hd-main .info .more-info .content a{display:block;padding-left:33px;height:30px;line-height:30px;color:#888}<br />
.hd-main .info .user-info .content a:hover,.hd-main .info .more-info .content a:hover{color:#333;text-decoration:none;background:#e0e1e5}<br />
.hd-main .info .user-info .li,.hd-main .info .more-info .li{display:block;padding:2px 0;height:30px}<br />
.hd-main .info .user-info .separate-li,.hd-main .info .more-info .separate-li{display:block;margin:3px 11px;border-top:#EBEBEC 1px solid;border-bottom:#FFF 1px solid}<br />
.hd-main .info .more-info{right:0}<br />
.hd-main .info .more-info .arrow{left:94px;*left:-8px}<br />
#apDiv1 {<br />
position:absolute;<br />
left:3px;<br />
top:4px;<br />
width:100%;<br />
height:900px;<br />
z-index:0;<br />
background-color: #66CCFF;<br />
}<br />
/*<![CDATA[*/<br />
body {<br />
margin:0;<br />
padding:0 10px 0 10px;<br />
border:0;<br />
height:100%;<br />
overflow:auto;<br />
background-color: #FFF;<br />
}<br />
#menu {right:0; top:0; width:100%; position:fixed; padding:10px; text-align:center; font-weight:bold; background:rgba(0,83,163,0);}<br />
* html #menu {position:absolute; right:16px; top:0;}/*only for ie*/<br />
html {overflow:auto !important; overflow:hidden;}<br />
<br />
#apDiv2 {<br />
position:absolute;<br />
left:0;<br />
top:50px;<br />
width:100%;<br />
height:265px;<br />
z-index:0;<br />
background-color: #187BDB;<br />
}<br />
#apDiv3 {<br />
position:absolute;<br />
left:0px;<br />
top:318px;<br />
width:100%;<br />
height:150px;<br />
z-index:0;<br />
}<br />
#apDiv3 table tr td p {<br />
font-size: 15px;<br />
text-align: left;<br />
}<br />
#apDiv4 {<br />
position:absolute;<br />
left:0;<br />
top:604px;<br />
width:100%;<br />
height:1396px;<br />
z-index:0;<br />
}<br />
#apDiv5 {<br />
position:absolute;<br />
left:0;<br />
top:2688px;<br />
width:100%;<br />
height:25;<br />
z-index:1;<br />
background-color: #5FC1C5;<br />
}<br />
#apDiv3 div {<br />
font-size: 15px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td div {<br />
font-size: 15px;<br />
color: #000;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td {<br />
font-size: 45px;<br />
line-height: 30px;<br />
}<br />
body,td,th {<br />
color: #000;<br />
}<br />
#apDiv6 {<br />
position:absolute;<br />
left:575px;<br />
top:2577px;<br />
width:220px;<br />
height:221px;<br />
z-index:2;<br />
}<br />
#apDiv2 table tr td p {<br />
font-size: 45px;<br />
text-align: center;<br />
color: #FFF;<br />
font-weight: bold;<br />
}<br />
#apDiv7 {<br />
position:absolute;<br />
left:50%;<br />
top:226px;<br />
width:257px;<br />
height:151px;<br />
z-index:auto;<br />
}<br />
#apDiv3 table tr td {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv8 {<br />
position:absolute;<br />
left:0;<br />
top:4900px;<br />
width:100%;<br />
height:1430px;<br />
z-index:0;<br />
}<br />
#apDiv8 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 {<br />
position:absolute;<br />
left:0;<br />
top:7331px;<br />
width:100%;<br />
height:213px;<br />
z-index:0;<br />
}<br />
#apDiv9 div p {<br />
font-size: 45px;<br />
}<br />
#apDiv9 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
text-align: left;<br />
}<br />
#apDiv8 table tr td p {<br />
font-size: 15px;<br />
line-height: 30px;<br />
}<br />
#apDiv9 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv8 table tr td div {<br />
font-size: 45px;<br />
text-align: center;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv4 table tr td table tr td div img {<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div img {<br />
text-align: center;<br />
font-size: 15px;<br />
}<br />
#apDiv8 table tr td div table tr td {<br />
font-size: 35px;<br />
}<br />
#apDiv9 table tr td div table tr td {<br />
font-size: 45px;<br />
}<br />
</style><br />
</head><br />
<br />
<body id="" class=""><br />
<div id="apDiv2"><br />
<table width="100%" border="0" ><br />
<tr><br />
<td width="1201" height="265" rowspan="2"><p><img src="https://static.igem.org/mediawiki/2014/thumb/8/84/2.wetlab.top.jpg/800px-2.wetlab.top.jpg" width="1366" height="270" /></p></td><br />
<td width="100%" height="199" bgcolor="#187ADB">&nbsp;</td><br />
</tr><br />
<tr><br />
<td height="70">&nbsp;</td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv3"><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td width="20%">&nbsp;</td><br />
<td width="60%"><p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;We constructed a pollutant substrate(PNP) bio-sensor coupling riboflavin synthetic gene cluster, the genetically modified E.coli can secrete riboflavin when added PNP in MFC anode medium.Riboflavin is a efficient redox mediator as well as a stimulator of MFC. We created a novel MFC devices and built a quantitative monitor system of PNP via measuring voltage increment.</p><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<p><img src="dht1 (1).jpg" width="238" height="75" /><img src="dht1 (2).jpg" width="229" height="75" /><img src="dht1 (3).jpg" width="204" height="75" /><img src="dht1 (4).jpg" width="299" height="75" /></p></td><br />
<td width="20%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p></p><br />
</div><br />
<div id="apDiv4" ><br />
<p>&nbsp;</p><br />
<table width="100%" height="627" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="550" valign="top"><p>&nbsp;</p><br />
<p>&nbsp;</p><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" height="50">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;INTRODUCTION</td><br />
</tr><br />
</table><br />
<table width="100%" border="0"><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="30%" height="1146"><p>&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="57%">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;<br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Why did we choose the MFC as our device? MFC is an abbreviation of microbial fuel cell.MFC is a bioreactor that can convert biomass energy into electricity through the metabolic activity of bacteria in the anode chamber.(<a href="#_ENREF_1" title="Du, 2007 #10">Du, Li, &amp; Gu, 2007</a>) . Nowadays, MFC is a new energy source available for us to solve pollution problem and produce electricity energy simultaneously. </p><br />
<p>&nbsp;</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/4/47/MFC_sketch.png" width="555" height="479" /></p><br />
<p><br /><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;However, the main challenge of MFC is how to bring these technologies out of the laboratory and engineer practical systems for bioenergy production at larger scales. One of the most severe problems is the low efficiency of extracellular electron transfer without the help of redox mediators added manually into the reactor, such as neutral red, thionin (<a href="#_ENREF_5" title="Rabaey, 2005 #50">Rabaey &amp; Verstraete, 2005</a>) . The addition of these mediators seemed to be another troublesome pollutant to deal with.<br /><br />
</p><br />
<p><img src="https://static.igem.org/mediawiki/2014/1/1c/Duxuejing_cartoon_Bhalf.png" alt="" width="627" height="304" align="middle" /></p><br />
<p>&nbsp;</p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In our study, we successfully constructed a power stimulating model to solve this puzzle. We use <em>Shewanella</em>, a well-known star of electricity-producing bacteria family, as our devices&rsquo; powerful engine, it can send forth bacterial <em>nanowires and reach the highest power output peak</em>. Furthermore, we construct an extraordinary &ldquo;<em>Turbo Boost</em>&rdquo; device&mdash;genetically modified E.coli system&mdash;to stimulate this process. The hero of this story is riboflavin, a natural redox mediator also known as Vitamin B2. Our E.coli system can produce a certain amount of riboflavin, which concentration is dependent on substrate&rsquo;s quantity, using a pollutant substrate bio-sensor coupling riboflavin synthetic gene cluster. </p><br />
<p><img src="https://static.igem.org/mediawiki/2014/6/6e/Old_MFC_photo.png" alt="" width="455" height="340" /></p><br />
<p>&nbsp; </p><br />
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;In that system, we can monitor pollutant concentration real-timely by measuring the voltage of MFC devices and demonstrate result via data processing center and mobile network application.</p><br />
<div></div><br />
<p>&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center">&nbsp;</p><br />
<p align="center"><script type="text/javascript"><br />
var _bdhmProtocol = (("https:" == document.location.protocol) ? " https://" : " http://");<br />
document.write(unescape("%3Cscript src='" + _bdhmProtocol + "hm.baidu.com/h.js%3F986011a32f84f432107ce07502765e79' type='text/javascript'%3E%3C/script%3E"));<br />
</script><br />
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</p></td><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="13%">&nbsp;</td><br />
</tr><br />
</table><br />
<p>&nbsp;</p><br />
<p>&nbsp;</p></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv5"><br />
<table width="1365" border="0""><br />
<tr><br />
<td background="https://static.igem.org/mediawiki/2014/a/a6/Huils.jpg" width="1365" height="463"><img src="https://static.igem.org/mediawiki/2014/0/07/Dblbluebar.jpg" width="1365" height="463" /></td><br />
</tr><br />
</table><br />
</div><br />
<div id="apDiv6"><img src="https://static.igem.org/mediawiki/2014/6/6e/Lzulogo.png" width="220" height="221" /></div><br />
<div ><br />
<div style=" height:890px;"> </div><br />
<div id="menu"><br />
<script type="text/javascript" src="/ajaxjs/jquery-1.6.2.min.js"></script><br />
<script type="text/javascript"><br />
$(document).ready(function(){<br />
$(".def-nav,.info-i").hover(function(){<br />
$(this).find(".pulldown-nav").addClass("hover");<br />
$(this).find(".pulldown").show();<br />
},function(){<br />
$(this).find(".pulldown").hide();<br />
$(this).find(".pulldown-nav").removeClass("hover");<br />
});<br />
});<br />
</script><br />
<div class="hd-main clearfix" id="header"><br />
<a class="logo" href="https://2014.igem.org/Team:LZU-China"></a><br />
<div class="navs"><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China">Home</a><br />
<span class="separate"></span><br />
<div class="def-nav current has-pulldown-special"><br />
<a class="pulldown-nav" href=""><em class="f-icon"></em>Project</a><br />
<div class="pulldown app-url"><br />
<div class="content"><br />
<a class="li disk" href="https://2014.igem.org/Team:LZU-China/background"><br />
<span class="icon"></span><br />
<span class="text">Background</span><br />
</a><br />
<a class="li tongxunlu" href="https://2014.igem.org/Team:LZU-China/wetlab"><br />
<span class="icon"></span><br />
<span class="text">Wet Lab</span><br />
</a><br />
<a class="li xiangce" href="https://2014.igem.org/Team:LZU-China/drylab"><br />
<span class="icon"></span><br />
<span class="text">Dry Lab</span><br />
</a><br />
<a class="li note" href="https://2014.igem.org/Team:LZU-China/Parts"><br />
<span class="icon"></span><br />
<span class="text">Parts</span><br />
</a><br />
<a class="li duanxin" href="https://2014.igem.org/Team:LZU-China/interlab"><br />
<span class="icon"></span><br />
<span class="text">Interlab</span><br />
</a><br />
<a class="li zhaohui" href="https://2014.igem.org/Team:LZU-China/future"><br />
<span class="icon"></span><br />
<span class="text">Future Work</span><br />
</a><br />
</div><br />
</div><br />
</div><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Notebook">Note Book</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/Safety">Safety</a><br />
<span class="separate"></span><br />
<a class="def-nav" href="https://2014.igem.org/Team:LZU-China/hp">H. Practice</a><br />
</div><br />
<div class="info"><br />
<ul><br />
<li class="info-i user-name has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<a class="f-icon identity" href="https://2014.igem.org/Team:LZU-China/Team" title="Our team"></a><br />
<span class="name top-username">Our Team</span><br />
<div class="pulldown user-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Team">Team Members</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Advisors</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Instructors">Instructors</a></span><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/Attribution">Attribution</a></span><br />
<span class="li"><a href="https://2014.igem.org/Team:LZU-China/acknowledgement">Acknowledgement</a></span><br />
<span class="separate-li no-height"></span><br />
</div><br />
</div><br />
</li><br />
<li class="info-i no-separate default-text has-pulldown"><br />
<em class="f-icon pull-arrow"></em><br />
<span class="more" hideFocus="hideFocus">More</span><br />
<div class="pulldown more-info"><br />
<em class="arrow"></em><br />
<div class="content"><br />
<span class="separate-li no-height"></span><br />
<span class="li"><a href="">Team Profile</a></span><br />
<span class="li"><a href="http://en.lzu.edu.cn/">Lanzhou University</a></span><br />
<span class="li"><a href="https://2013.igem.org/Team:LZU-China">LZU-CHINA 2013</a></span><br />
</div><br />
</div><br />
</li><br />
</ul><br />
</div><br />
</div><br />
<div style="text-align:center;margin:50px 0; font:normal 14px/24px 'MicroSoft YaHei';"><br />
</div><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
</div><br />
</body><br />
<br />
<br />
<br />
<br />
<br />
<script type="text/javascript"><br />
function MM_showHideLayers() { //v9.0<br />
var i,p,v,obj,args=MM_showHideLayers.arguments;<br />
for (i=0; i<(args.length-2); i+=3) <br />
with (document) if (getElementById && ((obj=getElementById(args[i]))!=null)) { v=args[i+2];<br />
if (obj.style) { obj=obj.style; v=(v=='show')?'visible':(v=='hide')?'hidden':v; }<br />
obj.visibility=v; }<br />
}<br />
</script></div>
Lzuzx