http://2014.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Kgizdov2014.igem.org - User contributions [en]2024-03-29T14:30:26ZFrom 2014.igem.orgMediaWiki 1.16.5http://2014.igem.org/Team:Aberdeen_ScotlandTeam:Aberdeen Scotland2015-01-21T14:27:19Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland">Overview</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Aberdeen iGEM Team 2014</h1><br />
<h3>Wake up to the Sleeping Sickness</h3><br />
<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Igem_logo_exp.png"><br />
<br><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<h4>The team was awarded a Gold medal and two special prizes:</h4><br />
<ul><br />
<ul><br />
<li><b>Best Health & Medicine Project</b> - Winner of Health & Medicine Track</li><br />
<li><b>Best Innovation in Measurement</b> - Special Prize for unique assay design</li><br />
</ul><br />
</ul><br />
<img src="https://static.igem.org/mediawiki/2014/d/d0/Awards_1.jpg"><br />
<h4>*Ana and Konstantin receiving our two special prizes</h4><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<p>Trypanosoma brucei gambiense, the causative agent of Human African Trypanosomiasis (HAT) (commonly known as African Sleeping Sickness), infects 30,000 people<br />
worldwide, with 60 million at disease risk. Unrecognised, this disease is fatal, but accurate diagnosis, relying on detection of patient serum antibodies against two<br />
different trypanosomal antigens, Variable Surface Glycoprotein LiTat 1.3 and Variable Surface Glycoprotein LiTat 1.5, allows successful treatment.</p><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/Parasite.png"><br />
<h3>Our project and achievements</h3><br />
<p>We engineered autotransporters Antigen43 (Ag43) and Ice-Nucleation protein (INP) to successfully express surface epitopes in <i>E.coli</i>, that mimic the two different<br />
trypanosomal antigens. Therefore, we created standardised and user-friendly Ag43 and INP BioBricks ready for peptides of choice to be cloned in. Two <i>E.coli</i> strains<br />
were generated, each expressing a distinct surface epitope and either a quorum sensing sender or receiver module respectively. We delivered a proof-of-principle<br />
demonstration of our project, by showing that the quorum-based system is capable of detecting cell surface Ag43-FLAG ‘Receiver’ <i>E.coli</i> in an anti-FLAG bead pull-<br />
down. These ‘Receivers’ co-cultured with AHL-synthesising ‘Senders’ produced a strong –FLAG-tag dependent, AHL-inducible GFP response. This system if applied in a<br />
real life scenario could effectively diagnose a neglected tropical disease such as Trypanosomiasis, using patient serum-derived antibodies, with minimal facilities.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Diag.png"><br><br><br />
<h3>The user-friendly, portable, inexpensive GFP detection device</h3><br />
<p>We constructed a cheap, Raspberry Pi computer-controlled fluorimeter suitable for developing countries, showing it could detect QS fluorescence output. The<br />
detection device costs around $100 and could replace heavy and expensive microscopes, to make the detection system affordable to remote populations in Africa.</p><br><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/GFP_detector.png"><br><br><br />
<h3>Novel applications</h3><br />
<p>This novel application to diagnose patient exposure to tropical pathogens integrates antigen display and quorum sensing to implement AND logic sensing. It<br />
facilitates cheap, simple diagnosis of neglected tropical diseases such as HAT. Future diagnosis kits can be constructed and modularized using the cheap and self-<br />
replenishing <i>E. coli</i> based detection system we created as a platform for displaying two different mimotopes. Mimotopes are shortened versions of real epitopes<br />
identified for a panel of diseases, all of which are currently stored in a universal database, available to everyone and known as MimoDB [http://immunet.cn/mimodb].<br />
Moreover, it was recently shown that upon heat-treatment of Ag43 autotransporter-foreign peptide complex at 60°C, a chimeric form of the expressed foreign protein<br />
can be isolated and remain fully active. The chimeric protein was then used to induce an immune response and to develop a novel vaccine for cancer therapy (Huang et<br />
al., 2014). Therefore, we suggest that further research can be done on Ag43-trypanosomal mimotope/ other mimotope complexes for a potential first vaccine for HAT/<br />
other diseases.</p><br />
<p><b>Reference:</b> Huang, F., Li, L., Liu, Q., Li, Y., Bai, R., Huang, Y., Zhao, H., Guo, J., Zhou, S., Wang, H. and others, (2014). Bacterial surface display of<br />
endoglin by antigen 43 induces antitumor effectiveness via bypassing immunotolerance and inhibition of angiogenesis. International Journal of Cancer, 134(8),<br />
pp.1981--1990.</p><br />
</div><br />
<br />
<div class="external"><br />
<p>You can find our official iGEM Registry Page <a href="https://igem.org/Team.cgi?year=2014&team_name=Aberdeen_Scotland">here</a>.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_ScotlandTeam:Aberdeen Scotland2015-01-21T14:26:51Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland">Overview</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Aberdeen iGEM Team 2014</h1><br />
<h3>Wake up to the Sleeping Sickness</h3><br />
<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Igem_logo_exp.png"><br />
<br><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<h4>The team was awarded a <b>Gold medal</b> and two special prizes:</h4><br />
<ul><br />
<ul><br />
<li><b>Best Health & Medicine Project</b> - Winner of Health & Medicine Track</li><br />
<li><b>Best Innovation in Measurement</b> - Special Prize for unique assay design</li><br />
</ul><br />
</ul><br />
<img src="https://static.igem.org/mediawiki/2014/d/d0/Awards_1.jpg"><br />
<h4>*Ana and Konstantin receiving our two special prizes</h4><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<p>Trypanosoma brucei gambiense, the causative agent of Human African Trypanosomiasis (HAT) (commonly known as African Sleeping Sickness), infects 30,000 people<br />
worldwide, with 60 million at disease risk. Unrecognised, this disease is fatal, but accurate diagnosis, relying on detection of patient serum antibodies against two<br />
different trypanosomal antigens, Variable Surface Glycoprotein LiTat 1.3 and Variable Surface Glycoprotein LiTat 1.5, allows successful treatment.</p><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/Parasite.png"><br />
<h3>Our project and achievements</h3><br />
<p>We engineered autotransporters Antigen43 (Ag43) and Ice-Nucleation protein (INP) to successfully express surface epitopes in <i>E.coli</i>, that mimic the two different<br />
trypanosomal antigens. Therefore, we created standardised and user-friendly Ag43 and INP BioBricks ready for peptides of choice to be cloned in. Two <i>E.coli</i> strains<br />
were generated, each expressing a distinct surface epitope and either a quorum sensing sender or receiver module respectively. We delivered a proof-of-principle<br />
demonstration of our project, by showing that the quorum-based system is capable of detecting cell surface Ag43-FLAG ‘Receiver’ <i>E.coli</i> in an anti-FLAG bead pull-<br />
down. These ‘Receivers’ co-cultured with AHL-synthesising ‘Senders’ produced a strong –FLAG-tag dependent, AHL-inducible GFP response. This system if applied in a<br />
real life scenario could effectively diagnose a neglected tropical disease such as Trypanosomiasis, using patient serum-derived antibodies, with minimal facilities.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Diag.png"><br><br><br />
<h3>The user-friendly, portable, inexpensive GFP detection device</h3><br />
<p>We constructed a cheap, Raspberry Pi computer-controlled fluorimeter suitable for developing countries, showing it could detect QS fluorescence output. The<br />
detection device costs around $100 and could replace heavy and expensive microscopes, to make the detection system affordable to remote populations in Africa.</p><br><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/GFP_detector.png"><br><br><br />
<h3>Novel applications</h3><br />
<p>This novel application to diagnose patient exposure to tropical pathogens integrates antigen display and quorum sensing to implement AND logic sensing. It<br />
facilitates cheap, simple diagnosis of neglected tropical diseases such as HAT. Future diagnosis kits can be constructed and modularized using the cheap and self-<br />
replenishing <i>E. coli</i> based detection system we created as a platform for displaying two different mimotopes. Mimotopes are shortened versions of real epitopes<br />
identified for a panel of diseases, all of which are currently stored in a universal database, available to everyone and known as MimoDB [http://immunet.cn/mimodb].<br />
Moreover, it was recently shown that upon heat-treatment of Ag43 autotransporter-foreign peptide complex at 60°C, a chimeric form of the expressed foreign protein<br />
can be isolated and remain fully active. The chimeric protein was then used to induce an immune response and to develop a novel vaccine for cancer therapy (Huang et<br />
al., 2014). Therefore, we suggest that further research can be done on Ag43-trypanosomal mimotope/ other mimotope complexes for a potential first vaccine for HAT/<br />
other diseases.</p><br />
<p><b>Reference:</b> Huang, F., Li, L., Liu, Q., Li, Y., Bai, R., Huang, Y., Zhao, H., Guo, J., Zhou, S., Wang, H. and others, (2014). Bacterial surface display of<br />
endoglin by antigen 43 induces antitumor effectiveness via bypassing immunotolerance and inhibition of angiogenesis. International Journal of Cancer, 134(8),<br />
pp.1981--1990.</p><br />
</div><br />
<br />
<div class="external"><br />
<p>You can find our official iGEM Registry Page <a href="https://igem.org/Team.cgi?year=2014&team_name=Aberdeen_Scotland">here</a>.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_ScotlandTeam:Aberdeen Scotland2015-01-21T14:26:11Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland">Overview</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Aberdeen iGEM Team 2014</h1><br />
<h3>Wake up to the Sleeping Sickness</h3><br />
<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Igem_logo_exp.png"><br />
<br><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<h4>The team was awarded a Gold medal and two special prizes:</h4><br />
<ul><br />
<ul><br />
<li><b>Best Health & Medicine Project</b> - Winner of Health & Medicine Track</li><br />
<li><b>Best Innovation in Measurement</b> - Special Prize for unique assay design</li><br />
</ul><br />
</ul><br />
<img src="https://static.igem.org/mediawiki/2014/d/d0/Awards_1.jpg"><br />
<h4>*Ana and Konstantin receiving our two special prizes</h4><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<p>Trypanosoma brucei gambiense, the causative agent of Human African Trypanosomiasis (HAT) (commonly known as African Sleeping Sickness), infects 30,000 people<br />
worldwide, with 60 million at disease risk. Unrecognised, this disease is fatal, but accurate diagnosis, relying on detection of patient serum antibodies against two<br />
different trypanosomal antigens, Variable Surface Glycoprotein LiTat 1.3 and Variable Surface Glycoprotein LiTat 1.5, allows successful treatment.</p><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/Parasite.png"><br />
<h3>Our project and achievements</h3><br />
<p>We engineered autotransporters Antigen43 (Ag43) and Ice-Nucleation protein (INP) to successfully express surface epitopes in <i>E.coli</i>, that mimic the two different<br />
trypanosomal antigens. Therefore, we created standardised and user-friendly Ag43 and INP BioBricks ready for peptides of choice to be cloned in. Two <i>E.coli</i> strains<br />
were generated, each expressing a distinct surface epitope and either a quorum sensing sender or receiver module respectively. We delivered a proof-of-principle<br />
demonstration of our project, by showing that the quorum-based system is capable of detecting cell surface Ag43-FLAG ‘Receiver’ <i>E.coli</i> in an anti-FLAG bead pull-<br />
down. These ‘Receivers’ co-cultured with AHL-synthesising ‘Senders’ produced a strong –FLAG-tag dependent, AHL-inducible GFP response. This system if applied in a<br />
real life scenario could effectively diagnose a neglected tropical disease such as Trypanosomiasis, using patient serum-derived antibodies, with minimal facilities.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Diag.png"><br><br><br />
<h3>The user-friendly, portable, inexpensive GFP detection device</h3><br />
<p>We constructed a cheap, Raspberry Pi computer-controlled fluorimeter suitable for developing countries, showing it could detect QS fluorescence output. The<br />
detection device costs around $100 and could replace heavy and expensive microscopes, to make the detection system affordable to remote populations in Africa.</p><br><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/GFP_detector.png"><br><br><br />
<h3>Novel applications</h3><br />
<p>This novel application to diagnose patient exposure to tropical pathogens integrates antigen display and quorum sensing to implement AND logic sensing. It<br />
facilitates cheap, simple diagnosis of neglected tropical diseases such as HAT. Future diagnosis kits can be constructed and modularized using the cheap and self-<br />
replenishing <i>E. coli</i> based detection system we created as a platform for displaying two different mimotopes. Mimotopes are shortened versions of real epitopes<br />
identified for a panel of diseases, all of which are currently stored in a universal database, available to everyone and known as MimoDB [http://immunet.cn/mimodb].<br />
Moreover, it was recently shown that upon heat-treatment of Ag43 autotransporter-foreign peptide complex at 60°C, a chimeric form of the expressed foreign protein<br />
can be isolated and remain fully active. The chimeric protein was then used to induce an immune response and to develop a novel vaccine for cancer therapy (Huang et<br />
al., 2014). Therefore, we suggest that further research can be done on Ag43-trypanosomal mimotope/ other mimotope complexes for a potential first vaccine for HAT/<br />
other diseases.</p><br />
<p><b>Reference:</b> Huang, F., Li, L., Liu, Q., Li, Y., Bai, R., Huang, Y., Zhao, H., Guo, J., Zhou, S., Wang, H. and others, (2014). Bacterial surface display of<br />
endoglin by antigen 43 induces antitumor effectiveness via bypassing immunotolerance and inhibition of angiogenesis. International Journal of Cancer, 134(8),<br />
pp.1981--1990.</p><br />
</div><br />
<br />
<div class="external"><br />
<p>You can find our official iGEM Registry Page <a href="https://igem.org/Team.cgi?year=2014&team_name=Aberdeen_Scotland">here</a>.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_ScotlandTeam:Aberdeen Scotland2015-01-21T14:22:24Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland">Overview</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Aberdeen iGEM Team 2014</h1><br />
<h3>Wake up to the Sleeping Sickness</h3><br />
<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Igem_logo_exp.png"><br />
<br><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<img src="https://static.igem.org/mediawiki/2014/d/d0/Awards_1.jpg"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<p>Trypanosoma brucei gambiense, the causative agent of Human African Trypanosomiasis (HAT) (commonly known as African Sleeping Sickness), infects 30,000 people<br />
worldwide, with 60 million at disease risk. Unrecognised, this disease is fatal, but accurate diagnosis, relying on detection of patient serum antibodies against two<br />
different trypanosomal antigens, Variable Surface Glycoprotein LiTat 1.3 and Variable Surface Glycoprotein LiTat 1.5, allows successful treatment.</p><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/Parasite.png"><br />
<h3>Our project and achievements</h3><br />
<p>We engineered autotransporters Antigen43 (Ag43) and Ice-Nucleation protein (INP) to successfully express surface epitopes in <i>E.coli</i>, that mimic the two different<br />
trypanosomal antigens. Therefore, we created standardised and user-friendly Ag43 and INP BioBricks ready for peptides of choice to be cloned in. Two <i>E.coli</i> strains<br />
were generated, each expressing a distinct surface epitope and either a quorum sensing sender or receiver module respectively. We delivered a proof-of-principle<br />
demonstration of our project, by showing that the quorum-based system is capable of detecting cell surface Ag43-FLAG ‘Receiver’ <i>E.coli</i> in an anti-FLAG bead pull-<br />
down. These ‘Receivers’ co-cultured with AHL-synthesising ‘Senders’ produced a strong –FLAG-tag dependent, AHL-inducible GFP response. This system if applied in a<br />
real life scenario could effectively diagnose a neglected tropical disease such as Trypanosomiasis, using patient serum-derived antibodies, with minimal facilities.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Diag.png"><br><br><br />
<h3>The user-friendly, portable, inexpensive GFP detection device</h3><br />
<p>We constructed a cheap, Raspberry Pi computer-controlled fluorimeter suitable for developing countries, showing it could detect QS fluorescence output. The<br />
detection device costs around $100 and could replace heavy and expensive microscopes, to make the detection system affordable to remote populations in Africa.</p><br><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/GFP_detector.png"><br><br><br />
<h3>Novel applications</h3><br />
<p>This novel application to diagnose patient exposure to tropical pathogens integrates antigen display and quorum sensing to implement AND logic sensing. It<br />
facilitates cheap, simple diagnosis of neglected tropical diseases such as HAT. Future diagnosis kits can be constructed and modularized using the cheap and self-<br />
replenishing <i>E. coli</i> based detection system we created as a platform for displaying two different mimotopes. Mimotopes are shortened versions of real epitopes<br />
identified for a panel of diseases, all of which are currently stored in a universal database, available to everyone and known as MimoDB [http://immunet.cn/mimodb].<br />
Moreover, it was recently shown that upon heat-treatment of Ag43 autotransporter-foreign peptide complex at 60°C, a chimeric form of the expressed foreign protein<br />
can be isolated and remain fully active. The chimeric protein was then used to induce an immune response and to develop a novel vaccine for cancer therapy (Huang et<br />
al., 2014). Therefore, we suggest that further research can be done on Ag43-trypanosomal mimotope/ other mimotope complexes for a potential first vaccine for HAT/<br />
other diseases.</p><br />
<p><b>Reference:</b> Huang, F., Li, L., Liu, Q., Li, Y., Bai, R., Huang, Y., Zhao, H., Guo, J., Zhou, S., Wang, H. and others, (2014). Bacterial surface display of<br />
endoglin by antigen 43 induces antitumor effectiveness via bypassing immunotolerance and inhibition of angiogenesis. International Journal of Cancer, 134(8),<br />
pp.1981--1990.</p><br />
</div><br />
<br />
<div class="external"><br />
<p>You can find our official iGEM Registry Page <a href="https://igem.org/Team.cgi?year=2014&team_name=Aberdeen_Scotland">here</a>.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/File:Awards_1.jpgFile:Awards 1.jpg2015-01-21T14:20:40Z<p>Kgizdov: </p>
<hr />
<div></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Project/DiseaseTeam:Aberdeen Scotland/Project/Disease2014-10-18T02:58:22Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Project/Disease - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Overview</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Disease">The Disease</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Methods">Current Methods</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Design">Our Design</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Assay">Assay</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Device">Device</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Trypanosomiasis</h1><br />
<h3>Human African Trypanosomiasis (Sleeping Sickness) Epidemiology</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p>Over 98% of reported cases of Human African Trypanosomiasis (HAT) are caused by a chronic infection of parasite <i>Trypanosoma brucei gambiense</i>. Its vector is through the bite of an infected Tsetse fly in sub-saharan Africa.</p><br />
<p>WHO estimates as of 2014, 30,000 people are currently infected, with more than 80% of new cases occurring in Democratic Republic of the Congo.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7b/Afr.png" width="60%" height="60%"></center><br />
<p><i>T.b. gambiense</i> sufferers may be infected for months or even years without major signs or symptoms of the disease. When more evident symptoms emerge, the patient is often already in an advanced disease stage where the central nervous system is affected.</p><br />
<p>During epidemic periods prevalence reached 50% in several villages in the Angola, Democratic Republic of Congo, and South Sudan. Sleeping sickness was the first or second greatest cause of mortality in those communities, ahead of even HIV/AIDS.<p><br />
<p>The World Health Organisation included HAT in its roadmap for elimination and control of neglected tropical diseases in 2012, setting a date of 2020 to eliminate the disease as a public health problem.</p><br />
<p>2% of reported cases are due to <i>T.b. rhodesiense</i>, which is an acute infection, however this figure may be skewed by the fact this develops rapidly, invading the central nervous system with symptoms appearing after only a few weeks or months. If it persists, infected have a similar prognosis of almost unanimous mortality.</p><br />
<p>Chagas disease of South America is of a different subgenus, <i>Trypanosoma cruzi</i>, and utilises a different vector, Triatominae (‘assassin bugs’).</p><br />
<h3>Disease Progression</h3><p></p><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/Trypanosoma-evansi-rat-blood-Giemsa-stain.jpg"><br />
Giemsa-stained trypanasoma parasites in blood<br />
<p><i>T. b. gambiense</i> stage 1 exists free in blood serum or lymph, usually pathogens like this will be quickly destroyed by an active immune response, however it exhibits antigenic variation of its LiTat1.3/1.5 coat that changes every 20 minutes with over 100 possible phenotypes encoded in its chromosome; this negates an active immunity from being effectively generated.</p><br />
<p>After a period of approximately 6 months it progresses to stage 2 where the parasite enters the central nervous system, here it is protected from an immune response and may proliferate at will. Clearer symptoms emerge at this point including muscle weakness, sleep disturbance, partial paralysis, parkinsonism, psychosis and other psychiatric symptoms, and coma. If untreated, <i>T. b. gambiense</i> almost always results in death.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Project/DiseaseTeam:Aberdeen Scotland/Project/Disease2014-10-18T02:52:18Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Project/Disease - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Overview</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Disease">The Disease</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Methods">Current Methods</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Design">Our Design</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Assay">Assay</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project/Device">Device</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Trypanosomiasis</h1><br />
<h3>Human African Trypanosomiasis (Sleeping Sickness) Epidemiology</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p>Over 98% of reported cases of Human African Trypanosomiasis (HAT) are caused by a chronic infection of parasite <i>Trypanosoma brucei gambiense</i>. Its vector is through the bite of an infected Tsetse fly in sub-saharan Africa.</p><br />
<p>WHO estimates as of 2014, 30,000 people are currently infected, with more than 80% of new cases occurring in Democratic Republic of the Congo.</p><br />
<center><img src="https://static.igem.org/mediawiki/2014/7/7b/Afr.png" width="60%" height="60%"></center><br />
<p><i>T.b. gambiense</i> sufferers may be infected for months or even years without major signs or symptoms of the disease. When more evident symptoms emerge, the patient is often already in an advanced disease stage where the central nervous system is affected.</p><br />
<p>During epidemic periods prevalence reached 50% in several villages in the Angola, Democratic Republic of Congo, and South Sudan. Sleeping sickness was the first or second greatest cause of mortality in those communities, ahead of even HIV/AIDS.<p><br />
<p>The World Health Organisation included HAT in its roadmap for elimination and control of neglected tropical diseases in 2012, setting a date of 2020 to eliminate the disease as a public health problem.</p><br />
<p>2% of reported cases are due to <i>T.b. rhodesiense</i>, which is an acute infection, however this figure may be skewed by the fact this develops rapidly, invading the central nervous system with symptoms appearing after only a few weeks or months. If it persists, infected have a similar prognosis of almost unanimous mortality.</p><br />
<p>Chagas disease of South America is of a different subgenus, <i>Trypanosoma cruzi</i>, and utilises a different vector, Triatominae (‘assassin bugs’).</p><br />
<h3>Disease Progression</h3><br />
<img src="https://static.igem.org/mediawiki/2014/c/cb/Trypanosoma-evansi-rat-blood-Giemsa-stain.jpg"><br />
<p><i>T. b. gambiense</i> stage 1 exists free in blood serum or lymph, usually pathogens like this will be quickly destroyed by an active immune response, however it exhibits antigenic variation of its LiTat1.3/1.5 coat that changes every 20 minutes with over 100 possible phenotypes encoded in its chromosome; this negates an active immunity from being effectively generated.</p><br />
<p>After a period of approximately 6 months it progresses to stage 2 where the parasite enters the central nervous system, here it is protected from an immune response and may proliferate at will. Clearer symptoms emerge at this point including muscle weakness, sleep disturbance, partial paralysis, parkinsonism, psychosis and other psychiatric symptoms, and coma. If untreated, <i>T. b. gambiense</i> almost always results in death.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/File:Trypanosoma-evansi-rat-blood-Giemsa-stain.jpgFile:Trypanosoma-evansi-rat-blood-Giemsa-stain.jpg2014-10-18T02:50:31Z<p>Kgizdov: </p>
<hr />
<div></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/DeviceTeam:Aberdeen Scotland/Parts/Device2014-10-18T02:31:26Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Detector Test Data</h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p>The initial concept of the fluorescence detector device had a very rough design. Thus it was built from bits and pieces in order to do a preliminary test and<br />
verify its viability.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/a/a0/Rough_set.jpg"><br />
<br />
<p>The preliminary data from the tests showed that the detector was able to differentiate between GFP producing and non-producing bacteria.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/e/e9/Lb_vs_gfp.png"><br />
<br />
<p>Fig.1 Series dilutions to estimate detector sensitivity</p><br />
<br />
<p>From Fig.1 we can see that the detector can easily distinguish the GFP producing culture from below 1/10 dilutions. Thus we continued on and improved the design by soldering some of the circuit and making it more compact. Then we made more test with the Sender and Receiver bacteria.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/3/33/Send_rec_vs.png"><br />
<p>Fig.2 Detector response to Sender and Receiver cultures</p><br />
<br />
<p>Again the detector is sensitive enough to pick up the GFP in the Receiver.</p><br />
<br />
<p>For the final test, we made clean overnight cultures of the Receiver and Sender and mixed them in a growing culture. This was done to see after how long the detector is going to pick up the GFP production. Hence, if our diagnostic method is going to work.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/7/79/Resp_time.png"><br />
<p>Fig.3 Detector response to QS GFP-producing Receiver and Sender culture, normalised against LB medium</p><br />
<br />
<p><b>Finally, the simple detector proved capable of detecting the QS culture, thus confirming our design success.</b></p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/EthicsTeam:Aberdeen Scotland/Ethics2014-10-18T02:27:26Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA App</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1></h1><br />
<h3>Our part in helping to develop Scottish national science policy in the area of synthetic biology</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<p>The Aberdeen team was fortunate to be able to accept an invitation to an event on 16th October organised by the Chief Scientific Advisor of Scotland, Prof Muffy<br />
Calder. Prof. Calder is a Scottish government-appointed scientist whose role is to advise the Scottish government on science issues as they impact on government<br />
policy.</p><br />
<br />
<p>Prof. Calder co-chairs the <a href="http://www.scottishscience.org.uk/">Scottish Scientific Advisory Council (SSAC)</a>, an government body providing scientific<br />
advice to government, and currently engaged with producing a report on the future development of synthetic biology as a tool for biotechnology in Scotland. We, the<br />
Aberdeen iGEM team were invited to the launch event for the SSAC Report on Synthetic biology: opportunities for Scotland, where we were asked to present a poster on<br />
our iGEM project to evidence the development of synthetic biology in Scotland. We had the opportunity to speak to a number of key figures in this area, including<br />
Prof Calder, and Prof. Nigel Brown, President of the Society for General Microbiology and co-author of the report. We considered that we had contributed in some<br />
small way to the development of synthetic biology policy, and were participants in the process of development of national science policy in this area. We regarded<br />
ourselves as privileged to see how national science policies, including those on synthetic biology are developed in our country, as well as to be able to speak to<br />
Scottish policy makers at the event.</p><br />
<br />
<p>The Scottish SSAC report on Synthetic biology: opportunities for Scotland: A report by the Scottish Science Advisory Council will be published on 17th September<br />
2014.</p><br />
<br />
<div class="float"><a href="http://www.scottishscience.org.uk/"><img src="https://static.igem.org/mediawiki/2014/9/90/SSAClogo.png"></a></div><br />
<br />
<h4>iGEM Aberdeen: public outreach and science communication</h4><br />
<p>The Aberdeen team used a number of outreach opportunities to engage with non-scientists and the general public. Each provided the opportunity to engage with a lay<br />
audience, and find out what the public thinks of the science of synthetic biology. We discussed our science and presented at the following events.</p><br />
<br />
<p><b>SCHMU Radio, Aberdeen:</b> our team was interviewed on the SHMU local radio station for 20 minutes on the Talking Science show, giving us the chance to<br />
communicate our project, and the concept of synthetic biology, to an audience in the Aberdeen city area.</p><br />
<br />
<audio controls><br />
<source src="https://static.igem.org/mediawiki/2014/f/f2/Joe_Radio.mp3" type="audio/mpeg"><br />
Your browser does not support the audio element.<br />
</audio><br />
<br />
<p><b>Explorathon 2014:</b> this annual European event is a vast science public outreach event giving researchers from across Europe the chance to showcase their<br />
science to a general public audience. On <a href="http://www.explorathon.co.uk/aberdeen">Explorathon day</a> (26th September 2014), our contribution was present to<br />
an open audience in a quick-fire Pecha Kucha event (20 slides, 20 seconds each) held in the Belmont cinema in Aberdeen city centre. This open event was attended by a<br />
large number of members of the public, followed by a Q&A session.</p><br />
<br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3qMgndUmz_Q" frameborder="0" allowfullscreen></iframe><br />
<br />
<p><b>iGEM project blog with <a href="http://www.aumag.co.uk/">AU Magazine</a>:</b> our team had a great opportunity to engage with non-scientists through a 3-part<br />
blog we produced in the Aberdeen University science magazine 'Au'. This magazine is written for a non-scientific audience, providing an important outreach<br />
opportunity.</p><br />
<br />
<h5>Our goal for publishing a series of articles was to:</h5><br />
<ul><br />
<li><br />
<ul style="list-style-type:disc"><br />
<li>Address the general public's misconceptions surrounding synthetic biology</li><br />
<li>Popularise SynBio</li><br />
<li>Get people thinking about how synthetic biology can provide solutions to serious global issues we face nowadays</li><br />
<li>To start a discussion about the ethical implication of our actions; Our moral responsibility to use knowledge to do good, as well as looking at the<br />
sustainability of synthetic biology in the future</li><br />
<li>To popularize iGEM</li><br />
<li>To inspire readers of the magazine (fellow students) and show that young people can make a positive contribution and tackle global problems</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<h4>To date we have published 2 articles:</h4><br />
<ul><br />
<li><br />
<h5><b><a href="https://static.igem.org/mediawiki/2014/9/9e/A_Young_Physicist.pdf">A Young Physicist’s perspective on Synthetic Biology</a></b> by Konstantin Gizdov, in which we<br />
addressed the following:</h5><br />
<ul><br />
<li>- What is iGEM</li><br />
<li>- What is synthetic biology, emphasizing its interdisciplinary aspect and debunking myths surrounding 'the Frankenstein's biology'</li><br />
<li>- Why are physicists involved in biology projects? How the modelling can guide informed design of biological research</li><br />
<li>- The unlimited potential of synbio and how we implement it in everyday life</li><br />
<li>- The risks and ethical implications connected with irresponsible applications of synbio, and how it is tackled by laws and regulations</li><br />
</ul><br />
</li><br />
<li><br />
<h5><a href="https://static.igem.org/mediawiki/2014/a/a4/IGEM-Blogpost_2.pdf"><b>Wake up to the sleeping sickness!</b></a> by Ana-Maria Cujba, our grand plan to engineer an E. coli<br />
System for the diagnosis of neglected tropical diseases:</h5><br />
<ul><br />
<li>- What is Human African Trypanosomiasis (HAT)</li><br />
<li>- The burden of the disease</li><br />
<li>- Difficulties with diagnosing HAT</li><br />
<li>- How to engineer a diagnostic system adapted to function effectively in remote parts of Africa and how synthetic biology enables us to do so</li><br />
<li>- The solution - our E.coli operated diagnosis system and a HAT detector device</li><br />
<li>- The positive impact of our project</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<p>Our third article about the Giant iGEM Jamboree and an exchange of ideas within an international scientific community will be published in mid-November. We will<br />
emphasize the international aspect of the competition and how all teams work together to perform high quality, safe science.</p><br />
<br />
<h4>Interactions with the Scottish Health Service</h4><br />
<p>In addition to the above outreach, as part of the project planning we also contacted a nearby National Health Service lab (Ms Leslie Bevridge, Grampian health<br />
authority Microbiology pathology lab) to identify possible disease targets for a new diagnosis tool. While we eventually settled on tropical disease diagnosis in<br />
remote areas we were still periodically in contact throughout the project, often regarding our weekly progress.</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003Team:Aberdeen Scotland/Parts/ 20032014-10-18T02:24:49Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_3013">Bba_k523013</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
<h1><br>INP+YFP+His</h1><br />
<br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
This brick was successfully created but in an ampicillin backbone and as such was not physically submitted to iGEM, details about its characterisation can be found on the registry entry for it here: <a href="http://parts.igem.org/Part:BBa_K1352003">BBa_K1352003</a><br />
<br />
<p></p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003Team:Aberdeen Scotland/Parts/ 20032014-10-18T02:24:37Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_3013">Bba_k523013</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
<h1><br>INP+YFP+His</h1><br />
<br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
This brick was successfully created but in an ampicillin backbone and as such was not physically submitted to iGEM, details about its characterisation can be found on the registry entry for it here: <a href="http://parts.igem.org/Part:BBa_K1352003">BBa_K135203</a><br />
<br />
<p></p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/ModelingTeam:Aberdeen Scotland/Modeling2014-10-18T02:20:33Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Modelling - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Introduction</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling/QS">Quorum Sensing</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling/GFP">GFP Response</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling/Assay">Assay Sensitivity</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Modelling Aims</h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Purpose</h3><br />
<p></p><br />
<p>In order to verify and characterize our diagnostic system we created mathematical models for each individual component. Modeling and simulations were essential<br />
techniques that guided our approach from design to completion. As the main point of interest in our system was inter-cellular communication and its optimization, we<br />
employed ODEs and PDEs as our main mathematical tools.</p><br />
<img src="https://static.igem.org/mediawiki/2014/a/a7/AjkIkdjfmkJ.png"><br />
<h3>Quorum Sensing</h3><br />
<p>We developed a spacial model for analyzing Quorum Sensing between cells and then studied it under our system desired conditions. This gave us insight into how<br />
best structure our assay.</p><br />
<h3>GFP Response</h3><br />
<p>By simulating GFP response we made sure our system will react in a predictable manner and in an appropriate amount of time. We ensured that simulations agreed with<br />
data so that we can rely on reproducibility.</p><br />
<h3>Assay Sensitivity</h3><br />
<p>As with any other test, sensitivity is a main factor. The test needed to be sensitive enough to detect HAT, but also tolerant to noise, so that false-positives<br />
were minimized. We explored the process of antibody binding to make sure we meet those criteria.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/File:AjkIkdjfmkJ.pngFile:AjkIkdjfmkJ.png2014-10-18T02:20:04Z<p>Kgizdov: </p>
<hr />
<div></div>Kgizdovhttp://2014.igem.org/File:Results1.pngFile:Results1.png2014-10-18T02:16:31Z<p>Kgizdov: uploaded a new version of &quot;File:Results1.png&quot;</p>
<hr />
<div></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002Team:Aberdeen Scotland/Parts/ 90022014-10-18T02:11:58Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<br />
<h1>Our characterisation of existing BioBrick T9002 </h1><br />
<h2>GFP Producer Controlled by 3OC6HSL Receiver Device</h2><br />
<br><br />
<h3>Aims and Rationale</h3><br />
<br />
BioBrick BBa_T9002 on a pSB1C3 backbone is a composite part encoding a quorum sensing (QS) receiver driving expression of green fluorescent protein. T9002 was previously reported to exhibit increased GFP expression in the presence of AHL (N-acyl homoserine lactone). <br />
<br><br />
<br><br />
We aimed to confirm GFP-expression responsiveness and dependence of AHL, and how the physical proximity of this QS receiver to any QS sender (producer of homoserine lactone) is facilitated by surface-binding affects quorum signalling.<br />
<br><br />
<br><br />
<br />
<h3>Materials and Methods</h3><br />
<br />
T9002 <i>E. coli</i> transformants were grown in conjunction with other <i>E. coli</i> transformed with the AHL ‘Sender’ plasmid BBa_K1090000. BBa_K1090000 codes for AHL-synthesising enzymes, and also constitutively expresses RFP.<br />
<br><br />
<br><br />
<br />
<b><i>Poly-L-lysine Cell Adhesion</i></b><br />
<br><br />
To investigate QS signalling, and how it is affected by binding of sender and receiver bacteria to a solid surface, we immobilised our cells on a surface coated with poly-lysine: <br />
<br />
<br><br />
<br><br />
<br />
1. 50μl 0.01% Poly-Lysine was added to each well of a 96 well glass-bottom Plate (Whatman), and incubated at room temperature for 2 hours<br />
<br />
<br><br />
<br><br />
<br />
2. Excess poly-lysine was removed and the plate washed three times with sterile water and allowed to dry at room temperature.<br />
<br />
<br><br />
<br><br />
<br />
3. <i>E. coli</i> cultures were grown overnight in a 37C shaking water bath, and diluted to an optical density-600nm(OD600) of 0.02. <br />
<br />
<br><br />
<br><br />
<br />
4. K1090000 ‘Sender’ transformants washed by centrifugation at 13000rpm for 1minute and resuspension in phosphate buffered saline (PBS), three times.<br />
<br />
<br><br />
<br><br />
<br />
5. Dual Sender-Receiver wells were diluted and combined in a colorimetric ratio to achieve a total OD600 of 0.02, with a range of 1:1 to 1:10,000,000 Sender:Receiver. 50μl total volume in Liquid Broth (LB) used per well. Incubated at 4C for 1 hour.<br />
<br />
<br><br />
<br><br />
<br />
6. Unbound cells removed by lightly shaking over waste and washed three times with Phosphate-Buffered Saline (PBS). 50μl fresh LB medium was added to each well.<br />
<br />
<br><br />
<br><br />
<br />
7. A FluoSTAR OPTIMA Fluoresence Plate Reader was used to measure Red(Excitation 544nm/Emission 612nm) and Green(Excitation 485nm/Emission 520nm) Fluorescence was recorded every 5 minutes for 7 hours; this incubates the samples at 37 degrees C and shakes (1mm double-orbital) for 30 seconds before each read.<br />
<br />
<br><br><br />
<h3>Results</h3><br />
<br />
<b><i>K1090000 RFP expression</b></i> RFP expression of K1090000 transformed <i>E. coli</i> was compared against untransformed XL1-Blue <i>E. coli</i> negative control and an RFP pSB1C3 plasmid positive control. Analysis of red fluorescence using a fluorimeter plate reader clearly shows that K1090000 constitutively expressed moderate amounts of RFP (Figure 1). <br />
<br><br />
<br><br />
<b><i>T9002 with AHL</b></i><br />
<br><br />
T9002 <i>E. coli</i> was resuspended in conditioned growth medium containing AHL, derived from a filter sterilised K1090000 suspension. The T9002 transformants in this medium as expected displayed a slow, exponential increase in GFP, indicating the T9002 receiver cells were responding to the QS signalling caused by AHL in the medium. However, QS responses by the T9002 receivers were even more marked when T9002 transformants were co-cultured with K109000 QS sender transformants (Figure 2). <br />
<br />
<br><br />
<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/4/48/FIG1-T9002.png"><br />
<br><br />
<font size="2">Figure 1 - K1090000 <i>E. coli</i> constitutively expresses RFP. Red (Excitation 544nm/Emission 612nm) fluorescence of K1090000 <i>E. coli</i> (triangles), RFP positive control pSB1C3 (Circles), untransformed XL1-Blue <i>E. coli</i> (dashes).<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<b><i>T9002 with K1090000 </b></i> We observed that optimal conditions for absolute green fluorescent production by T9002 receiver transformants were a ‘sender’ (S) to ‘receiver’ (R) ratio of 1:100; Figure 3. It was inferred that ratios greater or smaller than this resulted in too little AHL or undesirable competition effects, preventing optimal GFP fluorescence. An untransformed XL1-Blue <i>E. coli</i> (X) acted as control.<br />
<br />
<br><br />
<br />
T9002 Receivers in the presence of K1090000 Sender exhibit significantly higher GFP response than T9002 with a control (non-AHL expressing untransformed XL1-Blue <i>E. coli</i>); Figure 4. <br />
<br />
<br><br />
<br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/7/7a/FIG2-T9002.png"><br />
<br><br />
<font size="2">Figure 2 – Production of GFP by T9002, induced either by filtered AHL-containing culture medium, or by actively growing K1090000 sender transformants. AHL derived from culture medium is sufficient for slow rate T9002 Receiver GFP production (-), although T9002 GFP production was more efficient when paired with actively-growing K1090000 senders (circles). Mean GFP fluorescence of <i>E.coli</i> free in 50μl suspensions incubated at 37C, 1mm double-orbital shaking for 30 seconds every 5 minutes for 355 minutes.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/c/c9/FIG3-T9002.png"><br />
<br><br />
<font size="2">Figure 3 – Greatest absolute fluorescence by T9002 transformants is observed in a Sender (S) 1:100 Receiver (R) cell number initial ratio. T9002 Receiver-produced GFP was compared with that produced when paired with an untransformed XL1-Blue <i>E. coli</i> (X) control or K1090000 Senders (circles), in triplicate. 50μl suspensions were incubated at 37C, 1mm double-orbital shaking for 30 seconds every 5 minutes for 355 minutes.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/9/91/FIG4-T9002.png"><br />
<br><br />
<font size="2">Figure 4 – K1090000 Sender <i>E. coli</i> induction increased GFP expression in T9002 Receivers. Growth started in cell number ratios of aliquots totalling OD600 0.02 densities, suspended in liquid LB. Untransformed XL1-Blue:Receiver 1:100 ratio (Filled Diamonds), Sender:Receiver 1:100 ratio (Open circles). Values are blank corrected.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<i><b>T9002 and K1090000 bound to a Poly-Lysine surface; </i></b> Overall, immobilised Sender/Receiver pairs exhibited a greater extended rate of GFP production response, and higher absolute response after 7 hours than sender-receiver pairs free in suspension; Figure 5.<br />
<br />
<br><br />
<br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/7/7d/FIG5-T9002.png"><br />
<br><br />
<font size="2">Figure 5: Surface-immobilisation of sender-receiver QS tranformants results in improved GFP expression. Poly-L-lysine wells (triangles) had greater rate of response compared to cells free in suspension (circles). This was performed in a Sender 1:10 Receiver cell number ratio.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<h3>Conclusions</h3><br />
<br />
• BBa_K1090000 ‘Sender’ is an effective AHL expressor that is able to activate BBa_T9002 ‘Receiver’ GFP production. <br />
<br><br />
• BBa_K1090000 has moderate constitutive RFP expression.<br />
<br><br />
• BBa_T9002 is an AHL receiver coupled to a GFP reporter, it has ‘leaky’ GFP expression. <br />
<br><br />
• GFP production significantly increases in the presence of AHL.<br />
<br><br />
• Poly-Lysine surface-immobilisation of T9002 and K1090000 <i>E. coli</i> extends the longterm production rate of GFP expression.<br />
<br><br />
<br><br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000Team:Aberdeen Scotland/Parts/ 00002014-10-18T02:11:44Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<h1>Our characterisation of existing BioBrick K1090000 </h1><br />
<h2>AHL signal sender with RFP reporter under lac promoter control</h2><br />
<br><br />
<h3>Aims and Rationale</h3><br />
<br />
BioBrick BBa_K1090000 on a pSB1C3 backbone is a composite part encoding a quorum sensing (QS) sender driving production expression of AHL (N-acyl homoserine lactone), while also constitutively expressing red fluorescent protein (RFP). <br />
<br><br />
<br><br />
We aimed to confirm the constitutive RFP-expression, but also the ability of this composite part to direct the production of biologically active AHL. In combination with an AHL-responsive QS receiver BioBrick (T9002), we also aimed to investigate how the efficiency of QS signalling was positively or negatively affected by the physical proximity of this QS sender to any QS receiver (responder to homoserine lactone), through coincident surface-binding of the sender and receiver bacteria.<br />
<br><br />
Since the obvious way to audit the effectiveness of the QS Sender K1090000 BioBrick was to use a QS Receiver, we combined our experimental assessment of K1090000 and T9002 in a series of joint experiments. Therefore some of the experiments reported under K1090000 are the same as those reported for T9002 (see adjacent Experience tab, this section of the Wiki).<br />
<br><br><br />
<br />
<h3>Materials and Methods</h3><br />
<br />
K1090000 <i>E. coli</i> transformants were grown in conjunction with other <i>E. coli</i> transformed with the AHL ‘Receiver’ plasmid BBa_T9002. BBa_K1090000 codes for AHL-synthesising enzymes, and also constitutively expresses RFP.<br />
<br><br />
<br><br />
<br />
<b><i>Poly-L-lysine Cell Adhesion</i></b><br />
<br><br />
To investigate QS signalling, and how it is affected by binding of sender and receiver bacteria to a solid surface, we immobilised our cells on a surface coated with poly-lysine: <br />
<br />
<br><br />
<br><br />
<br />
1. 50μl 0.01% Poly-Lysine was added to each well of a 96 well glass-bottom Plate (Whatman), and incubated at room temperature for 2 hours<br />
<br />
<br><br />
<br><br />
<br />
2. Excess poly-lysine was removed and the plate washed three times with sterile water and allowed to dry at room temperature.<br />
<br />
<br><br />
<br><br />
<br />
3. <i>E. coli</i> cultures were grown overnight in a 37C shaking water bath, and diluted to an optical density-600nm(OD600) of 0.02. <br />
<br />
<br><br />
<br><br />
<br />
4. K1090000 ‘Sender’ transformants washed by centrifugation at 13000rpm for 1minute and resuspension in phosphate buffered saline (PBS), three times.<br />
<br />
<br><br />
<br><br />
<br />
5. Dual Sender-Receiver wells were diluted and combined in a colorimetric ratio to achieve a total OD600 of 0.02, with a range of 1:1 to 1:10,000,000 Sender:Receiver. 50μl total volume in Liquid Broth (LB) used per well. Incubated at 4C for 1 hour.<br />
<br />
<br><br />
<br><br />
<br />
6. Unbound cells removed by lightly shaking over waste and washed three times with Phosphate-Buffered Saline (PBS). 50μl fresh LB medium was added to each well.<br />
<br />
<br><br />
<br><br />
<br />
7. A FluoSTAR OPTIMA Fluoresence Plate Reader was used to measure Red(Excitation 544nm/Emission 612nm) and Green(Excitation 485nm/Emission 520nm) Fluorescence was recorded every 5 minutes for 7 hours; this incubates the samples at 37 degrees C and shakes (1mm double-orbital) for 30 seconds before each read.<br />
<br />
<br><br><br />
<h3>Results</h3><br />
<br />
<b><i>K1090000 RFP expression</b></i> RFP expression of K1090000 transformed <i>E. coli</i> was compared against untransformed XL1-Blue <i>E. coli</i> negative control and an RFP pSB1C3 plasmid positive control. Analysis of red fluorescence using a fluorimeter plate reader clearly shows that K1090000 constitutively expressed moderate amounts of RFP (Figure 1).<br />
<br />
<br />
<br />
<br />
<br />
<b><i>K109000 is an efficient producer of QS-active AHL</b></i><br />
<br><br />
K1090000 transformants were grown overnight as a source of AHL. Medium from this culture was taken after the K1090000 cells had been removed by centrifugation and filter sterilisation. <i>E. coli</i> T9002 transformants (QS Receiver producing GFP in response to a QS signal) was resuspended in conditioned growth medium containing AHL, derived from the filter sterilised K1090000 suspension. The T9002 transformants in this medium as expected displayed a slow, exponential increase in GFP, indicating the T9002 receiver cells were responding to the QS signalling caused by AHL in the medium. However, QS responses by the T9002 receivers were even more marked when T9002 transformants were co-cultured with K109000 QS sender transformants (Figure 2). <br />
<br />
<br><br />
<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/4/48/FIG1-T9002.png"><br />
<br><br />
<font size="2">Figure 1 - K1090000 <i>E. coli</i> constitutively expresses RFP. Red (Excitation 544nm/Emission 612nm) fluorescence of K1090000 <i>E. coli</i> (triangles), RFP positive control pSB1C3 (Circles), untransformed XL1-Blue <i>E. coli</i> (dashes).<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<b><i>T9002 with K1090000 </b></i> We observed that optimal conditions for absolute green fluorescent production by T9002 receiver transformants were a K1090000 ‘sender’ (S) to ‘receiver’ (R) ratio of 1:100; Figure 3. It was inferred that ratios greater or smaller than this resulted in too little AHL or undesirable competition effects, preventing optimal GFP fluorescence. An untransformed XL1-Blue <i>E. coli</i> (X) acted as control.<br />
<br />
<br><br />
<br />
T9002 Receivers in the presence of K1090000 Sender exhibit significantly higher GFP response than T9002 with a control (non-AHL expressing untransformed XL1-Blue <i>E. coli</i>); Figure 4. This clearly shows the the K1090000 QS Senders were effective and efficient producers of AHL.<br />
<br />
<br><br />
<br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/7/7a/FIG2-T9002.png"><br />
<br><br />
<font size="2">Figure 2 – Production of GFP by T9002 Receiver, driven by either by filtered AHL-containing culture medium derived from K1090000 cultures, or by actively growing K1090000 sender transformants. AHL derived from culture medium is sufficient for slow rate T9002 Receiver GFP production (-), although T9002 GFP production was more efficient when paired with actively-growing K1090000 senders (circles). Mean GFP fluorescence of <i>E.coli</i> free in 50μl suspensions incubated at 37C, 1mm double-orbital shaking for 30 seconds every 5 minutes for 355 minutes.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/c/c9/FIG3-T9002.png"><br />
<br><br />
<font size="2">Figure 3 – Greatest absolute fluorescence by T9002 transformants is observed in a Sender (S) 1:100 Receiver (R) cell number initial ratio. T9002 Receiver-produced GFP was compared with that produced when paired with an untransformed XL1-Blue <i>E. coli</i> (X) control or K1090000 Senders (circles), in triplicate. 50μl suspensions were incubated at 37C, 1mm double-orbital shaking for 30 seconds every 5 minutes for 355 minutes.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/9/91/FIG4-T9002.png"><br />
<br><br />
<font size="2">Figure 4 – K1090000 Sender <i>E. coli</i> induction increased GFP expression in T9002 Receivers. Growth started in cell number ratios of aliquots totalling OD600 0.02 densities, suspended in liquid LB. Untransformed XL1-Blue:Receiver 1:100 ratio (Filled Diamonds), Sender:Receiver 1:100 ratio (Open circles). Values are blank corrected.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<i><b>T9002 and K1090000 bound to a Poly-Lysine surface; </i></b> Overall, immobilised Sender/Receiver pairs exhibited a greater extended rate of GFP production response, and higher absolute response after 7 hours than sender-receiver pairs free in suspension; Figure 5.<br />
<br />
<br><br />
<br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/7/7d/FIG5-T9002.png"><br />
<br><br />
<font size="2">Figure 5: Surface-immobilisation of sender-receiver QS tranformants results in improved GFP expression. Poly-L-lysine wells (triangles) had greater rate of response compared to cells free in suspension (circles). This was performed in a Sender 1:10 Receiver cell number ratio.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<h3>Conclusions</h3><br />
<br />
• BBa_K1090000 ‘Sender’ is an effective AHL expressor that is able to activate BBa_T9002 ‘Receiver’ GFP production. <br />
<br><br />
• BBa_K1090000 has moderate constitutive RFP expression.<br />
<br />
<br><br />
• Poly-Lysine surface-immobilisation of T9002 and K1090000 <i>E. coli</i> extends the longterm production rate of GFP expression.<br />
<br><br />
<br><br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007Team:Aberdeen Scotland/Parts/ 60072014-10-18T02:11:32Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br><br />
<h1>Our characterisation of existing BioBrick BBa_K346007</h1><br />
<h2>Antigen 43</h2><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<h3>Aim</h3><br />
To verify Assembly Standard 10 compliance<br><br><br />
<br />
<h3>Method</h3><br />
<u>Standard restriction digest and gel electrophoresis</u><br><br />
Escherichia coli bacterial culture containing plasmids BBa_K346007 (coding region of Ag43 only), was inoculated overnight in LB-chloramphenicol medium in a shaking water bath at 37370C. Plasmid mini preps were conducted with a Qiagen plasmid mini prep kit. Single and double restriction digests were carried out accordingly:<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/d/dd/Restriction_digest_table.png"><br />
</center><br />
<br><br />
Restriction digests with EcoRI, XbaI, SpeI and PstI was performed to linearize the vector and to confirm the existence of unique restriction sites, as required by the iGEM biobrick Assembly standard 10 rules. Double restriction digests with EcoRI plus PstI and XbaI plus SpeI were performed to separate the BBa_K346007 insert from the pSB1C3 plasmid backbone. Digests were incubated at 37370C for 2 hours and analysed by gel electrophoresis. Theoretical maps were used to calculate the expected sizes of the fragments and to compare them against the gel electrophoresis results.<br><br><br />
<br />
<h3>Results</h3><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/0/06/Restriction_digest_on_BBa_K346007.png"><br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Gel electrophoresis on standard restriction digests of BBa_K346007<br />
</font><br />
</center><br />
<br><br />
<br />
Restriction digests were separated on a 0.8% agarose gel. Lane 1; NEB 1 kb size standards ladder, Lane 2; uncut plasmid, Lanes 3-6; plasmid cut with either EcoRI, XbaI, SpeI or PstI respectively, Lane 7; plasmid cut with EcoRI+PstI, Lane 8; plasmid cut with XbaI+SpeI.<br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/d/dd/Restriction_digest_table.jpg"><br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp;Fragment sizes resulted from standard restriction digests on BBa_K346007.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<h3>Results</h3><br />
The pSB1C3-BBa_K346007 construct was shown to contain 6 additional PstI sites, as found in the wild-type gene of Antigen 43. This part is the basic part of BBa_K759001 Biobrick, which we have also shown that contains the same PstI sites (see Experience section of BBa_K759001).<br><br />
Thus we conclude that the BioBrick BBa_K346007 originally deposited with iGEM did not meet assembly standard 10, and the 6 native PstI sites present in Ag43 had not in fact been removed as stated in the original documentation.<br><br />
Based on the results mentioned above, pSB1C3-BBa_K759001 has been chosen as the subject for removal of the PstI sites to ensure that an Ag43 BioBrick is created that meets Assembly Standard 10 requirements (see the RFC10 compatible version of this Biobrick created by 2014 iGEM Aberdeen team:BBa_K1352000)<br><br><br />
<br />
<br />
<br />
</div><br />
<br />
<br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009Team:Aberdeen Scotland/Parts/ 20092014-10-18T02:11:17Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1><br>Our characterisation of existing BioBrick BBa_K542009</h1><br />
<h2>pLacI Regulated AG43</h2><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<br />
<h3>Aim</h3><br />
To verify Assembly Standard 10 compliance<br><br><br />
<br />
<h3>Method</h3><br />
Escherichia coli bacterial culture containing plasmids BBa_K542009 (coding region of Ag43 only), was inoculated overnight in LB-chloramphenicol medium in a shaking water bath at 37<sup>0</sup>C. Plasmid mini preps were conducted with a Qiagen plasmid mini prep kit. Single and double restriction digests were carried out accordingly:<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/d/dd/Restriction_digest_table.png"></center><br />
<br><br />
<br />
Restriction digests with EcoRI, XbaI, SpeI and PstI was performed to linearize the vector and to confirm the existence of unique restriction sites, as required by the iGEM biobrick Assembly standard 10 rules. Double restriction digests with EcoRI plus PstI and XbaI plus SpeI were performed to separate the BBa_K542009 insert from the pSB1C3 plasmid backbone. Digests were incubated at 370C for 2 hours and analysed by gel electrophoresis. Theoretical maps were used to calculate the expected sizes of the fragments and to compare them against the gel electrophoresis results.<br><br><br><br />
<br />
<h3>Results</h3><br />
<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/4/48/Restriction_digest_on_BBa_K542009.png"><br />
<br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Gel electrophoresis on standard restriction digests of BBa_K542009<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
Restriction digests were separated on a 0.8% agarose gel. Lane 1; NEB 1 kb size standards ladder, Lane 2; uncut plasmid, Lanes 3-6; plasmid cut with either EcoRI, XbaI, SpeI or PstI respectively, Lane 7; plasmid cut with EcoRI+PstI, Lane 8; plasmid cut with XbaI+SpeI.<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/7/7e/Fragment_sizes_BBa_K542009.png"><br />
<br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp;Fragment sizes resulted from standard restriction digests on BBa_K542009.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<h3>Conclusions</h3><br />
The gel results for the pSB1C3- BBa_K542009 construct suggested that the sequence has a deletion of approximately 1.2 kb, when compared to the theoretical map. Additionally, this Biobrick contains an extra XbaI site. Thus we conclude that the BioBrick BBa_K542009 originally deposited with iGEM did not meet assembly standard 10.<br><br />
Based on the results mentioned above, pSB1C3- BBa_K759001 has been chosen as the subject for removal of the PstI sites to ensure that an Ag43 BioBrick is created that meets Assembly Standard 10 requirements (see the RFC10 compatible version of this Biobrick created by 2014 iGEM Aberdeen team:BBa_K1352000)<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001Team:Aberdeen Scotland/Parts/ 90012014-10-18T02:11:03Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1><br>Our characterisation of existing BioBrick BBa_K759001</h1><br />
<h2>Aggregation Module inducible by arabinose in E.coli</h2><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<br />
<br />
<h3>Aim</h3><br />
<br />
To verify Assembly Standard 10 compliance<br><br><br />
<br />
<br />
<h3>Methods</h3><br />
<br />
<u>1. Standard restriction digest and gel electrophoresis</u><br><br />
Escherichia coli bacterial culture containing plasmids BBa_K759001 (coding region of Ag43 only), was inoculated overnight in LB-chloramphenicol medium in a shaking water bath at 370C. Plasmid mini preps were conducted with a Qiagen plasmid mini prep kit. Single and double restriction digests were carried out accordingly:<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/d/dd/Restriction_digest_table.png"><br />
<br><br />
</center><br />
<br><br><br />
<br />
Restriction digests with EcoRI, XbaI, SpeI and PstI was performed to linearize the vector and to confirm the existence of unique restriction sites, as required by the iGEM biobrick Assembly standard 10 rules. Double restriction digests with EcoRI plus PstI and XbaI plus SpeI were performed to separate the BBa_K759001 insert from the pSB1C3 plasmid backbone. Digests were incubated at 37370C for 2 hours and analysed by gel electrophoresis. Theoretical maps were used to calculate the expected sizes of the fragments and to compare them against the gel electrophoresis results.<br><br><br />
<br />
<br />
<br />
<u>2. Sequencing data</u><br><br />
The plasmid was sequenced by the DNA Sequencing Services at University of Dundee .Sequencing analysis was performed on BBa_K759001 to confirm the suspected additional PstI sites. 6 sequencing primers (see Fig.1) were designed that were located evenly across BBa_K759001 (sequence data was taken from the Registry of Standard Biological Parts) plus both BBa_G00100 (forward primer that amplifies from the prefix) and BBa_G00101 (reverse primer that amplifies from the suffix), as defined by iGEM, were used to sequence Ag43 flanked by the prefix and the suffix.<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/5/51/Sequencing_primers.png"><br />
<br><br />
</center><br />
<br><br><br />
<br />
<br />
<h3> Results</h3><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/c/c1/Restriction_digest_on_BBa_K759001.png"><br />
<br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Gel electrophoresis on standard restriction digests of BBa_K759001<br>Restriction digests were separated on a 0.8% agarose gel. Lane 1; NEB 1 kb size standards ladder, Lane 2; uncut plasmid, Lanes 3-6; plasmid cut with either EcoRI, XbaI, SpeI or PstI respectively, Lane 7; plasmid cut with EcoRI+PstI, Lane 8; plasmid cut with XbaI+SpeI.<br />
<br><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/2/28/Fragment_sizes_BBa_K759001.png"><br />
<br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp; Fragment sizes resulted from standard restriction digests on BBa_K759001<br />
</center><br />
<br><br><br />
<br />
<br />
<br />
Assembly of the sequencing data was performed manually using the CLUSTAL OMEGA multiple alignment program. The resulting sequence (query) was then compared against the original sequence for BBa_K759001 (subject) (sequence of 4493 bp, as taken from the Registry of Standard Biological Parts), using BLAST Pairwise sequence alignment viewer:<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/9/9b/Assembly_sequence_BBa_K759001.png"><br />
</center><br />
<br><br><br />
Based on the sequencining data, a PstI restriction map of the pSB1C3-BBa_K759001 construct was drawn using SnapGene Viewer:<br><bR><br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/a/a4/Plasmid_map_BBak759001.png"><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<h3>Conclusions</h3><br />
Both restriction digest and sequencing data show that biobrick BBa_K759001 contains 6 additional PstI sites (CTGCA^G) within the coding region of Antigen 43. Data suggests that the theoretical removal of the 6 additional sites from the coding region of Ag43 within BBa_K759001 is not confirmed by sequencing; therefore the construct is not standardized.<br><br />
Based on the availability of the sequencing data and the results mentioned above, pSB1C3- BBa_K759001 has been chosen as the subject for removal of the PstI sites to ensure that an Ag43 BioBrick is created that meets Assembly Standard 10 requirements (see the RFC10 compatible version of this Biobrick created by 2014 iGEM Aberdeen team: Bba_K1352000)<br><br><br />
<br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/DeviceTeam:Aberdeen Scotland/Parts/Device2014-10-18T02:10:49Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Detector Test Data</h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p>The initial concept of the fluorescence detector device had a very rough design. Thus it was built from bits and pieces in order to do a preliminary test and<br />
verify its viability.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/a/a0/Rough_set.jpg"><br />
<br />
<p>The preliminary data from the tests showed that the detector was able to differentiate between GFP producing and non-producing bacteria.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/e/e9/Lb_vs_gfp.png"><br />
<br />
<p>Fig.1 Series dilutions to estimate detector sensitivity</p><br />
<br />
<p>From Fig.1 we can see that the detector can easily distinguish the GFP producing culture from below 1/10 dilutions. Thus we continued on and improved the design by soldering some of the circuit and making it more compact. Then we made more test with the Sender and Receiver bacteria.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/3/33/Send_rec_vs.png"><br />
<p>Fig.2 Detector response to Sender and Receiver cultures</p><br />
<br />
<p>Again the detector is sensitive enough to pick up the GFP in the Receiver.</p><br />
<br />
<p>For the final test, we made clean overnight cultures of the Receiver and Sender and mixed them in a growing culture. This was done to see after how long the detector is going to pick up the GFP production. Hence, if our diagnostic method is going to work.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/7/79/Resp_time.png"><br />
<p>Fig.3 Detector response to QS GFP-producing Receiver and Sender culture, normalised against LB medium</p><br />
<br />
<p>Finally, the simple detector proved capable of detecting the QS culture, thus confirming our design success.</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006Team:Aberdeen Scotland/Parts/ 20062014-10-18T02:10:28Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1><br>INP+FLAG</h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
K1352006 is a part which has a FLAG-tag octapeptide flanked by a multiple cloning site (MCS) inserted into Bba_K523013 (K523013 expresses ice nucleation protein (INP)); specifically, on the end of a linker, which is in turn on the C-terminus of INP and is in the same reading frame. The FLAG-tag is a BglII restriction site, followed by a FLAG octapeptide, followed by a HindIII restriction site; the sequence of which is as follows; the octapeptide is uppercase, the restriction sites are lowercase:<br><br />
(agatctGATTATAAAGATGATGATGATAAAaagctt)<br><br />
Attaching a FLAG-tag to the end of INP means that it will be expressed on the surface of the cell, the purpose of this is to allow the rapid insertion (via the MCS) of polypeptides (an antigen for example) to the C-terminus end of INP; this allows the surface expression of said polypeptide. For the 2014 Aberdeen iGEM project, this part was intended to be used as a trypanosome antigen displayer.<br><br><br />
<br />
<br />
<br />
<h3>Creation of INP-YFP-FLAG fragments followed by InFusion cloning</h3><br />
Four infusion primers (primers with one homologous half (lower case) to the template, and one “overhang” half (upper case), the last 15 nucleotides of which is homologous to another DNA fragment) were designed.<br><br><br />
“INP-VEC-F” (CGCGGCCGCTTCTAGAttaatacgactcactataggg)<br><br />
“INP-Rem-R” (aagctttttatcatcatcatctttataatcagatctTCCCGCCACGCTGC)<br><br />
“INP-FLAG-F” (AGATCTGATTATAAAGATGATGATGATAAAAAGCTTtaataatactagcaacatatcataacggagtg)<br><br />
“INP-VEC-R” (AGCGGCCGCTACTAGTtataaacgcagaaaggccc)<br><br><br />
Two INP-YFP-FLAG fragments were created by PCR amplification, both use K523013 as the template, the first uses “INP-VEC-F” and “INP-FLAG-R” primers, the second uses “INP-VEC-R” and “INP-FLAG-F” primers. The Clontech InFusion kit was used to recombine the two INP-YFP-FLAG fragments with pSB1C3 backbone (cut with Xba1 and Spe1); this kit was followed according to the manufacturer’s instructions.<br><br><br />
<br />
<br />
<h3>Restriction digest + Gel electrophoresis</h3><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/1/18/2006_1.PNG"><br />
<br><br />
<font size="2">Figure 1; Xba1 + HindIII restriction digest screen of recombinants. The recombinant which went on to become K1352006 is in lane 5. The “L” lane is DNA marker (ladder). The arrows are to highlight the distance travelled by the HindIII-negative recombinants.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/5/58/2006_2.PNG"><br />
<br><br />
<font size="2">Figure 2; restriction digest verification of plasmid K1352006<br />
<br>LEGEND:<br><br />
L 10,000bp – 500bp DNA marker “ladder”<br><br />
N K1352006 plasmid digested with no enzymes<br><br />
E K1352006 plasmid digested with EcoRI<br><br />
X K1352006 plasmid digested with XbaI<br><br />
S K1352006 plasmid digested with SpeI<br><br />
P K1352006 plasmid digested with PstI<br><br />
EP K1352006 plasmid digested with EcoRI and PstI<br><br />
XS K1352006 plasmid digested with XbaI and Spe1<br><br />
</font><br />
</center><br />
<br><br />
<br><br />
<br />
<br />
<br />
<h3>DNA Sequencing</h3><br />
The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers.<br><br><br />
“G101” (attaccgcctttgagtgagc)<br><br />
“G100” (tgccacctgacgtctaagaa)<br><br />
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)<br><br />
“36 INP-SEQ 2” (gaggttgctgttgccgac)<br><br />
“37 INP-SEQ 3” (ggtgtggaagccgacattc)<br><br><br />
The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/0/06/2006_3.PNG"><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<h3>Conclusions</h3><br />
The part is RFC 10 compatible. The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of the linker sequence after INP.<br><br><br />
<br />
<br />
<br />
<br />
</div><br />
<br />
<br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004Team:Aberdeen Scotland/Parts/ 20042014-10-18T02:10:15Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1><br>INP+YFP+FLAG</h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<br />
K1352004 is a part which has a FLAG-tag octapeptide flanked by a multiple cloning site (MCS) inserted into Bba_K523013 (K523013 expresses ice nucleation protein (INP) fused to yellow florescent protein (YFP) by a linker); specifically, on the end of the C-terminus of yellow florescence protein (YFP) and is in the same reading frame as INP+YFP. <br />
<br><br />
<br><br />
The FLAG-tag is a BglII restriction site, followed by a FLAG octapeptide, followed by a HindIII restriction site; the sequence of which is as follows; the octapeptide is uppercase, the restriction sites are lowercase:<br><br><br />
(agatctGATTATAAAGATGATGATGATAAAaagctt)<br><br><br />
Attaching a FLAG-tag to the end of YFP means that it will be expressed on the surface of the cell, the purpose of this is to allow the rapid insertion (via the MCS) of polypeptides (an antigen for example) to the C-terminus end of INP+YFP; this allows the surface expression of said polypeptide. For the 2014 Aberdeen iGEM project, this part was intended to be used as a trypanosome antigen displayer.<br><br><br />
<br />
Creation of INP-YFP-FLAG fragments followed by In-Fusion cloning Four infusion primers (primers with one homologous half (lower case) to the template, and one “overhang” half (upper case), the last 15 nucleotides of which is homologous to another DNA fragment) were designed.<br><br><br />
“INP-VEC-F” (CGCGGCCGCTTCTAGAttaatacgactcactataggg)<br><br />
“INP-FLAG-R” (AAGCTTTTTATCATCATCATCTTTATAATCAGATCTcttgtacagctcgtccatgc)<br><br />
“INP-FLAG-F” (AGATCTGATTATAAAGATGATGATGATAAAAAGCTTtaataatactagcaacatatcataacggagtg)<br><br />
“INP-VEC-R” (AGCGGCCGCTACTAGTtataaacgcagaaaggccc)<br><br><br />
Two INP-YFP-FLAG fragments were created by PCR amplification, both use K523013 as the template, the first uses “INP-VEC-F” and “INP-FLAG-R” primers, the second uses “INP-VEC-R” and “INP-FLAG-F” primers. The Clontech InFusion kit was used to recombine the two INP-YFP-FLAG fragments with pSB1C3 backbone (cut with Xba1 and Spe1); this kit was followed according to the manufacturer’s instructions.<br><br><br />
<br />
<h3>Confirmation of K1352004 DNA construct and the insertion of a MCS</h3><br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/5/5d/INPA_1.JPG"><br />
<br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp; Restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)<br><br />
<br><br />
Legends:<br><br />
L: 10,000bp – 500bp DNA marker “ladder”<br><br />
9: K1352004 plasmid undigested<br><br />
10: K1352004 plasmid digested with XbaI<br><br />
11: K1352004 plasmid digested with XbaI and HindIII<br><br />
12: K1352004 plasmid digested with XbaI and BglII<br><br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/2/2f/INP_2.JPG" width="80%" height="80%"><br />
<br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp;Restriction digest verification of plasmid K1352004<br />
<br><br><br />
Legends:<br><br />
L: 10,000bp – 500bp DNA marker “ladder”<br><br />
N: K1352004 plasmid digested with no enzymes<br><br />
E: K1352004 plasmid digested with EcoRI<br><br />
X: K1352004 plasmid digested with XbaI<br><br />
S: K1352004 plasmid digested with SpeI<br><br />
P: K1352004 plasmid digested with PstI<br><br />
EP: K1352004 plasmid digested with EcoRI and PstI<br><br />
SX: K1352004 plasmid digested with XbaI and Spe1<br><br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<h3>DNA Sequencing</h3><br />
The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers. <br><br><br />
“G101” (attaccgcctttgagtgagc)<br><br />
“G100” (tgccacctgacgtctaagaa)<br><br />
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)<br><br />
“36 INP-SEQ 2” (gaggttgctgttgccgac)<br><br />
“37 INP-SEQ 3” (ggtgtggaagccgacattc)<br><br><br />
The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).<br />
<br><br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/c/cd/MCS_in_INP-YFP-FLAG.JPG"><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<h3>Florescence Microscopy</h3><br />
The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/d/d1/Fluorescence_negative_control.PNG" width="75%" height="75%"><br />
<br><br />
<font size="2">Figure 3, Panel A; &nbsp;&nbsp;&nbsp;&nbsp;a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/2/22/K1352004_YFP_fluorescence.PNG" width="75%" height="75%"><br />
<br><br />
<font size="2">Figure 3, Panel B; &nbsp;&nbsp;&nbsp;&nbsp;a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/7/7f/K523013_positive_control.PNG" width="75%" height="75%"><br />
<br><br />
<font size="2">Figure 3, Panel C; &nbsp;&nbsp;&nbsp;&nbsp;a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<h3>Western Blot</h3><br />
Westerm Blot was performed to confirm the presence and size of the translated INP-YFP-FLAG protein.<br><br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/1/10/Western_blot_K1352004.png" width="60%" height="60%"><br />
<br><br />
<font size="2">Figure 4; &nbsp;&nbsp;&nbsp;&nbsp;Western Blot results.<br><br />
<br />
Legends (from left-to-right):<br><br />
1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1<br><br />
2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2<br><br />
3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1<br><br />
4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2<br><br />
5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3<br><br />
6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4<br><br />
7. Pre-stained protein marker “ladder” NuPAGE MES; <br>From top to bottom in kDa: 188, 98 (orange), 62, 49, 38, 28, 17 (purple), 14, 6, 3<br><br />
The four Ag43 lanes act as a negative control, they also contain a single FLAG-tag but Ag43 is a heavier protein than INP and as such has a different banding pattern.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<h3>Conclusions</h3><br />
The part is RFC 10 compatible. The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the C-terminus of YFP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies; it was for this reason that BBa_K1352006 was created.<br><br><br />
<br />
</div><br />
<br />
<br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/PartsTeam:Aberdeen Scotland/Parts2014-10-18T02:09:52Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1><br>Background to Parts Design</h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p><b>Antigen 43</b> (sometimes called Ag43 or fluffing protein) is a phase-variable outer membrane protein encoded by flu gene. It is native to E.Coli K12 strain<br />
and is usually expressed at about 50, 000 copies/cell. Ag34 precursor is 1039 amino acids long and subsequently becomes cleaved into alpha and beta chains (499 and<br />
488 amino acids long respectively). The beta subunit forms a β-barrel pore via which alpha-subunit translocates to the cell surface, and with which it remains non-<br />
covalently joined. The surface alpha chain can be released by a brief heat treatment at approx. 60<sup>o</sup>C.</p><br />
<p>Ag43 is an autotransporter protein, therefore it possesses all information necessary for translocation to the cell surface in its coding sequence.</p><br />
<p>Ag43 mediates autoaggregation, via a velcro-like mechanism (Heras et. al., 2014), and plays a role in <i>E.coli</i> biofilm formation.</p><br />
<p>Interestingly, the alpha subunit is able to express foreign peptide sequences on E.coli cell surface if inserted just in front of codon 148 (Kjærgaard et. al.,<br />
2002).</p><br><center><br />
<img src="https://static.igem.org/mediawiki/2014/f/f1/Ag43_back.png"><br><br />
<span style="font-size:11px">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Graphic representation of Ag43 autotransporter structure and process of autotransportation. <br>Source: Kjærgaard et. al., 2000; Van der Woude & Henderson, 2008 (modified).</span></p></center><br><br />
<p>The shape of α-subunit of Ag43 resembles letter L (Fig.2). It consists of a 'β-helix domain [which forms] the stem of the letter L, followed by three rungs<br />
flanked by four β-hairpin motifs that bend the protein by about 110° and a C-terminal (...) parallel β-helix domain [which forms] the bottom of the letter L' (Heras<br />
et. al., 2014). It has been indicated that this unique shape plays a crucial role in cell-to-cell aggregation via velcro-like mechanism, in which α-subunits form a<br />
dimer by coling around each other. This interaction is strengthened by Van der Waals interactions, hydrogen bonds and salt bridges facilitated by the L-shape (Heras<br />
et. al., 2014). Recent research demonstrates that disruption of the bend and straightening of the shape by removal of two β-hairpin sequences eliminates self-<br />
association of Ag43 proteins (Heras et. al., 2014). Removal of β-hairpins does not interfere with protein translocation to the cell surface membrane.</p><br />
<center> <p>Hairpin 1 sequence&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;268&nbsp;&nbsp;&nbsp;AATVTGTNRLGAFSVVA&nbsp;&nbsp;&nbsp;284</p><br />
<p>Hairpin 2 sequence&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;341&nbsp;&nbsp;&nbsp;GAAVSGTRSDGKAFSIG&nbsp;&nbsp;&nbsp;357</p><br></center><br />
<center><img src="https://static.igem.org/mediawiki/2014/b/b8/Ag43_small.png"><br><br />
<p><span style="font-size:11px">Fig.2&nbsp;&nbsp;&nbsp;A) Graphic representation of Ag43 alpha-subunit; B) Interaction between two alpha-subunits in a velcro-like mechanism of auto<br />
-aggregation; C) Disruption of L-shape and linearization of the alpha-subunit eliminates auto-aggregation properties.</span></p></center><br><br><br />
<p><b>Ice Nucleation Protein (INP)</b> is used by bacteria in nature to nucleate ice crystals at slightly sub-zero temperatures; these crystals cause frost-damage to<br />
plant tissues which releases nutrients allowing the bacteria to metabolise them. It is another autotransporter and is extremely similar to Ag43. It also has an<br />
alpha and beta region and inserts itself into the cell’s outer membrane in basically the same way indicated in the first diagram above. Unlike Ag43 where the<br />
foreign proteins are inserted at codon 148, in INP the protein is inserted on the C terminus. INP has been used by a number of researchers and iGEM teams to surface-<br />
display proteins of interest. Ag43 is perhaps a better surface-displayer as it protrudes further from the cell surface than INP, but INP is easier to engineer as it<br />
has a larger carrying-capacity and the gene is much smaller.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000Team:Aberdeen Scotland/Parts/ 20002014-10-18T02:09:37Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<h1>Ag43 with PstI sites removed under the control <br>of pBad/araC promoter</h1><br />
<br />
<br />
<h3>Abstract</h3><br />
<br />
<p>We describe the creation of BioBrick BBa_K1352000, the modularized version of BBa_K759001, which is compatible with iGEM Assemly Standard RCF10. Previous work by the Aberdeen 2014 iGEM team had clearly shown that both Ag43 containing BioBricks BBa_K346007 and BBa_K759001 contained the 6 native PstI sites that characterise the native Ag43 sequence. Also, BBa_K542009 was shown to contain an additional XbaI site and to have a smaller size than predicted. They were thus found to be non-compliant with assembly Standard 10. We describe the design and construction of the new BioBrick BBa_K1352000, and its verification using restriction digestion and DNA sequencing. Finally, we show that antigen 43 protein expression of biobrick BBa_K1352010 was not affected by the PCR-based Site-Directed Mutagenesis process. The biobrick works biologically as intended after modification and has the same response to arabinose induction: formation of culture aggregation.</p><br />
<br><br />
<br />
<br />
<br />
<br><br />
<br />
<h3>1. Structure and function</h3><br />
<br />
<p>Antigen 43 (Ag43), the product of the flu gene, is a cell-surface autotransporter protein found in Escherichia coli. It is expressed at about 50, 000 copies/cell and is initially synthesised as a precursor of 1039 amino acids. Upon removal of the signal peptide, the protein is transported to the cell surface and is composed of an α subunit (499 amino acids) at the N-terminus and a β subunit (488 amino acids) at the C-terminus (Kj\aergaard et al., 2002). Ag43 is mainly known to induce cell-to-cell aggregation and be involved in biofilm formation. However, as the necessary information required for auto transportation resides in the protein itself (Kj\aergaard et al., 2002), the main of our project was to use it as a platform for displaying specific peptides on the surface of E. coli. To accomplish this aim, we have modularized and characterized Biobrick BBa_K759001.</p><br />
<br />
<br><center><br />
<img src="https://static.igem.org/mediawiki/2014/5/5d/1352000a.jpg"><br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Representation of the autotransportation process through the Ag43 autotransporter. <br><br />
Source: Westfälische Wilhelms-Universität Münster, I. (2014).<br />
<br><br />
</font><br />
</center><br />
<br><br />
<br />
<h3>2. Aim</h3><br />
<p>To eliminate unwanted PstI sites from a pre-existing, non-compliant Ag43 BioBrick (BBa_K759001)</p><br />
<br />
<br><br />
<br><br />
<br />
<h3>3. Methods and Results</h3><br />
<br />
<h3>a. Site-Directed Mutagenesis</h3><br />
<br />
<p>Synonymous mutations at the 6 additional PstI sites were thus introduced through PCR-based Site-Directed Mutagenesis (Agilent Lightning Quik-Change mutagenesis kit) in the BBa_K759001 sequence, by using the following set of primers: </p><br />
<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/f/f6/1352000b.png"><br />
</center><br />
<br><br />
<br><br />
<br />
<p>Highlighted nucleotides represent the synonymous mutations introduced within the coding region of Ag43, to remove the PstI sites. For primer pairs 1,2,3,4 and 6, the restriction site for the PstI site (CTGCA^G) has been converted to CTGCAA. The amino acid glutamine was therefore preserved in the open reading frame of the sequence and has been selected according to the higher frequency of codon usage in E. coli. For primer pair 5, CTGCA^G has been changed to CTGCGG, to maintain the open reading frame of Ag43. By changing GCA TO GCC, alanine was conserved within the sequence. </p><br />
<br><br />
<br />
<br />
<h3>b. Restriction digest and gel electrophoresis</h3><br />
<br />
<p>Escherichia coli bacterial cultures containing both plasmids BBa_K759001 and BBa_K1352000 were inoculated overnight in LB-chloramphenicol medium in a shaking water bath at 37oC. Plasmid mini preps were conducted with a Qiagen plasmid mini prep kit. Single and double restriction digests were carried out accordingly:</p><br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/8/86/1352000c.png"><br />
</center><br />
<br><br />
<p>Restriction digests with EcoRI, XbaI, SpeI and PstI was performed to linearize the vector and to confirm the existence of unique restriction sites, as required by the iGEM biobrick Assembly standard 10 rules. Double restriction digests with EcoRI plus PstI and XbaI plus SpeI were performed to separate the inserts from the pSB1C3 plasmid backbone. Digests were incubated at 37oC for 2 hours and analysed by gel electrophoresis. Theoretical maps were used to calculate the expected sizes of the fragments and to compare them against the gel electrophoresis results.</p><br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/a/a2/K1352000d.jpg"><br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp;Gel electrophoresis on standard restriction digests of BBa_K759001 (top tier) versus BBa_K1352000 (bottom).<br />
<br><br />
</font><br />
</center><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br><br />
<br />
<p>Restriction digests were separated on a 1% agarose gel. Lane 1; NEB 1 kb size standards ladder, Lane 2; uncut plasmid, Lanes 3-6; plasmid cut with either EcoRI, XbaI, SpeI or PstI respectively, Lane 7; plasmid cut with EcoRI+PstI, Lane 8; plasmid cut with XbaI+SpeI, Lane 9; NEB 1 kb size standards ladder.</p><br />
<br><br />
<br><br />
<br />
<h3>c. Sequencing data and plasmid map</h3><br />
<br />
<p>The plasmid was sequenced by the DNA Sequencing Services at University of Dundee. Sequencing analysis was further performed on BBa_ K1352000 with the following sequencing primers: </p><br />
<br><center><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/7/79/1352000e.png"><br />
</center><br />
<br><br />
<br />
<p>Assembly of the sequencing data was performed manually using the CLUSTAL OMEGA multiple alignment program. The resulting sequence (query) was then compared against the sequenced BBa_K759001 (subject) using BLAST Pairwise sequence alignment viewer:</p> <br />
<br><br />
<p>Data suggests that the removal of the 6 additional sites through Site-Directed Mutagenisis from the coding region of Ag43 within BBa_K759001 is confirmed by sequencing.</p><br />
<br />
<br><br />
<p>The ExPASy Translate Tool has been used to translate the nucleotide sequences of both the BBa_K759001 and BBa_K1352000 constructs. The protein BLAST alignment tool has consequently used to compare the open reading frames of the two constructs. No indels were observed within the coding sequence of the BBa_K1352000 construct.</p><br />
<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/4/47/K1352000f.png"><br />
</center><br />
<br><br />
<h3>d. Physiology of BBa_K1352000</h3><br />
<br />
<p>Both BBa_K1352000 and a negative control were grown overnight in 5 mls LB medium+ chloramphenicol. In the morning, both liquid cultures were induced with 0.2% arabinose for over 2 hours to detect aggregation. The E.coli culture aggregates (as shown below, Figure 1), demonstrating the engineered gene now lacking PstI sites is functional.</p><br />
<br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/c/c2/K1352000g.jpg"><br><br />
<font size="2">Fig.3&nbsp;&nbsp;&nbsp;&nbsp;Physiology of BBa_K1352000 in response to 0.2% arabinose induction.<br><br />
Left: BioBrick BBa_K1352000; right: negative control (untransformed E.coli).<br />
<br><br />
</font><br />
</center><br />
<br />
<br />
<br />
<br><br />
<br />
<br />
<br><br />
<h3>4. Conclusion</h3><br />
<br />
<p>BBa_K1352010 is the correct, iGEM RFC10-compatible version of BBa_K759001. In our experience, BBa_K759001 is not RFC10 compatible, having 6 Pst1 sites (see 'Design' for BBa_K1352010). During the construction of BBa_K1352010, the removal of the 6 additional PstI sites through Site-Directed Mutagenesis was confirmed by gel electrophoresis and sequence analysis, with no indels being introduced within the coding region of the construct.</p><br />
<br><br />
<br><br />
<p>Antigen 43 protein expression of biobrick BBa_K1352010 was shown not to be affected by the PCR-based Site-Directed Mutagenesis process. The biobrick works biologically as intended after modification and has the same response to arabinose induction: formation of culture aggregation.</p><br />
<br><br />
<br><br />
<br />
<h3>References</h3><br />
<p>1. Kjaergaard, K., Hasman, H., Schembri, M. and Klemm, P. (2002). Antigen 43-mediated autotransporter display, a versatile bacterial cell surface presentation system. Journal of bacteriology, 184(15), pp.4197--4204.<br />
2.Westfälische Wilhelms-Universität Münster, I. (2014). Topics of Research. [online] Uni-muenster.de. Available at: http://www.unimuenster.de/Chemie.pz/forschen/ag/jose/topicsofresearch.html, [Accessed 29 Sep. 2014]. </p><br />
<br />
<br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001Team:Aberdeen Scotland/Parts/ 20012014-10-18T02:09:22Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<br />
<h1>Ag43+FLAG+MCS under the control of pBAD promoter </h1><br />
<br />
<br />
<h3>Abstract</h3><br />
<br />
<p> We describe the creation of Biobrick constrct Bba_K1352001 which expresses autotransporter Ag43 with an inserted FLAG epitope tag at codon 148, flanked by multiple cloning restriction sites (MCS). We describe the design and construction of the new Biobrick, and its verification using restriction digestion and DNA sequencing. We show using Western blot analysis that the BioBrick is successfully able to direct the expression of an 116.77 kDa FLAG-tagged protein. We also show using fluorescently-tagged antibodies that this Biobrick is able to direct the E.coli surface expression of FLAG-tagged Ag43. Finally we show that insertion of a FLAG-tag at amino acid 148 prevents the auto-aggregation capability of Ag43, creating a useful reagent that can be used for E. coli surface display. </p><br />
<br />
<br />
<h3>1. Structure and function</h3><br />
<br />
<p> Antigen 43 (sometimes called Ag43 or fluffing protein) is a phase-variable outer membrane protein encoded by flu gene. It is native to E.coli K12 strain and is usually expressed at about 50, 000 copies/cell. Ag34 precursor is 1039 amino acids long and subsequently becomes cleaved into alpha and beta chains (499 and 488 amino acids long respectively). The beta subunit forms a β-barrel pore via which alpha-subunit translocates to the cell surface, and with which it remains non-covalently joined. The surface alpha chain can be released by a brief heat treatment at approx. 60oC. Ag43 is an autotransporter protein, therefore it possesses all information necessary for translocation to the cell surface in its coding sequence. Ag43 mediates autoaggregation, via a velcro-like mechanism (Heras et. al., 2014), and plays a role in E.coli biofilm formation. Interestingly, the alpha subunit is able to express foreign peptide sequences on E.coli cell surface if inserted just in front of codon 148 (Kjærgaard et. al., 2002).</p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/2001a.png"><br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Graphic representation of Ag43 autotransporter structure and process of autotransportation. <br><br />
Source: Kjærgaard et. al., 2000; Van der Woude & Henderson, 2008 (modified).</font></center><br />
<br><br><br />
<br />
<br />
<br />
<h3>2. Biobrick description and potential uses</h3><br />
<br />
<p> BioBrick Bba_K1352001 is a modified version of the Bba_K1352000 BioBrick. It is composed of an Ag43 coding sequence with an in-frame FLAG epitope tag flanked by BglII and HindIII multiple cloning sites inserted within the alpha-subunit in front of codon 148 of Ag43. Expression of Ag43 is under the control of the pBAD promoter; it includes a ribosome binding site as well as two transcriptional terminators. Structure of the BioBrick was designed to allow easy insertion of foreign protein sequences of choice at codon 148 with a simple restriction digest with BglII and HindIII followed by ligation. Potential uses of this BioBrick include surface display of foreign peptide sequences, E.coli aggregation tests as well as synthetic vaccines production.</p><br />
<br />
<br />
<br />
<br />
<br />
<h3>3. Template for foreign peptide insertion</h3><br />
<br />
<br> <br />
Depending on the length, desired foreign peptide sequence can be purchased as oligos or a synthetic piece of DNA. In order to keep the foreign protein sequence in-frame, a following template should be used:<br />
<br> <br />
<br><br />
<br />
5' <i>gct gtg</i> <b>AGA TCT </b>(your sequence) <b><u>AAG CTT</b></u> <i>aac acc</i> 3' [note reading frame of Ag43 is indicated by nucleotide triplets]<br />
<br> <br />
<br><br />
<b>BglII recognition site</b>; <b><u>HindIII recognition site</b></u>; <i>sequence adjacent to foreign peptide insertion site</i><br />
<br> <br />
<br><br />
<br />
<br />
<br />
<h3>4. Making of the Biobrick and plasmid modularization</h3><br />
<br> <br />
<br />
Bba_K1352000 BioBrick was a starting material for this construct. FLAG tag flanked by BglII and HindIII MCS was inserted into Ag43 at codon 148 via an In-Fusion reaction (Clonetech). For a more detailed description of the construction of this BioBrick, please see: https://2014.igem.org/Team:Aberdeen_Scotland/Parts<br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/4/49/2001b.png"><br />
<br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp;Plasmid map of created BioBrick construct.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<h3>5. Construct testing - molecular biology aspect</h3><br />
<br> <br />
<i>a) Restriction digest with prefix and suffix enzymes</i><br />
<br />
<p> Single and double restriction digests were carried out in order to ensure that created BioBrick behaves as expected and yields desired band pattern. Single digests with EcoRI, XbaI, SpeI and PstI cause a single cut within the vector and therefore result in plasmid linearization. As expected, in all cases a single band at 6.6 kB position is visible, which corresponds to the full size of a vector. EcoRI+PstI and XbaI+SpeI result in the release of a BioBrick construct from a vector yielding two fragments (BioBrick fragment: 4580 bp and vector fragment: 2020 bp). Single cuts with BglII and HindIII aim to test insertion of FLAG flanked by multiple cloning sites; single digests result in construct linearization. Double digests with BglII+SpeI and HindIII+XbaI were carried out in order to provide more information whether FLAG+MCS construct was inserted at an expected site. </p><br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/9/95/2001c.png"><br />
<br><br />
<font size="2">Fig.3&nbsp;&nbsp;&nbsp;&nbsp;Restriction digest of created BioBrick with a range of restriction enzymes.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
The obtained bands correspond with expected pattern therefore we can assume that FLAG+MCS was inserted at or in proximity to codon 148.<br />
<br />
<br> <br />
<br> <br />
<br />
<br />
<i> b) Confirming BioBrick Bba_K1352001 construction using DNA sequencing</i><br />
<br> <br />
<br />
<p> Our Ag43+FLAG+MCS was sequenced by the DNA Sequencing & Services Unit, Dundee University. Sequencing primers spaced approximately every 600 bp were used to ensure good coverage. Fragments were combined together using Clustal Omega and yield a high confidence reading along the entire sequence. It confirmed the presence of an in-frame FLAG tag sequence flanked by BglII and HindIII restriction sites at codon 148 of Ag43. Our construct sequence was identical to that of the protein product of Bba_K1352000, with the exception of the codon 148 FLAG + multiple cloning site sequence. </p><br />
<br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/2/25/2001d.png"><br />
<br><br />
<font size="2">Fig.4&nbsp;&nbsp;&nbsp;&nbsp;Chromatogram obtained during the sequencing of created BioBrick. <br />
Important features highlighted: yellow - BglII cut site; green - FLAG tag; purple - HindIII cut site<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/e/e1/2001e.png"><br />
<br><br />
<font size="2">Fig.5&nbsp;&nbsp;&nbsp;&nbsp;Translation of the theoretical construct and actual sequencing data. Query: Ag43-FLAG sequencing data; <br><br />
Subject - theoretical Ag43-FLAG construct. Pink box - FLAG tag translation flanked by BglII and HindIII cut sites<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<br />
<h3>6. Testing the physiology and function of Ag43-FLAG (Bba_K1352001)</h3><br />
<br />
<br> <br />
<i> a) Confirming Ag43-FLAG expression with Western Blotting</i><br />
<br />
<br> <br />
<br />
Western Blots were used to confirm the expression of FLAG tag. Anti-FLAG antibody conjugated to horse radish peroxidase was used.<br />
<br> <br />
<br> <br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/7/7a/2001f.png"><br />
<br><br />
<font size="2">Fig.6&nbsp;&nbsp;&nbsp;&nbsp;Western blot of a total cell lysate of an E. coli Bba_K1352001 transformant, run on a 12% SDS-PAGE gel, blotted onto membrane and probed with an anti-FLAG antibody.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
Two prominent bands are present which roughly correspond to the expected sizes of 116.77 kDa and 56.7 kDa. The additional faint band most likely corresponds to a protein degradation product. Overall, the Western blot results confirmed expression of FLAG tagged protein of the sizes expected from Ag43.<br />
<br> <br />
<br />
<i> b) Confirming FLAG surface expression with anti-FLAG immunolabelling</i><br />
<br />
<br> <br />
<br> <br />
In order to investigate membrane localisation and accessibility for antibody binding, fluorescent immunolabelling and confocal microscopy were used.<br><Br><br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/4/4e/2001g.png"><br />
<br><br />
<font size="2">Fig.7&nbsp;&nbsp;&nbsp;&nbsp;Schematic representation of immunolabelling technique used.<br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
Cover slips were coated with 0.01% Poly-L-lysine to which cells expressing a construct were adhered. The cells were fixed using 4% paraformaldehyde for 30 minutes, without creating pores in their membrane. They were exposed to a monoclonal anti-FLAG mouse primary antibody, then an Alexxa633 fluorophore-conjugated Goat anti-mouse secondary antibody. Cells expressing the Ag43-FLAG construct were visualised at up to 100x magnification with a Cy5 (red) filter on an upright confocal microscope, this was contrasted against visual identification with brightfield. Unmodified Bba_K1352000 which does not express a FLAG-tagged Ag43 was used as a negative control.<br />
<br> <br />
<br> <br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/c/c2/2001h.png"><br />
<br><br />
<font size="2">Fig.8&nbsp;&nbsp;&nbsp;&nbsp;Results of the immunolabelling of created construct. A) red filter, B) brightfield, C) composite image.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/a/a4/2001i.png"><br />
<br><br />
<font size="2">Fig.9&nbsp;&nbsp;&nbsp;&nbsp;Imunolabelling of Bba_K1352000 (negative control). A) red filter, B) brightfield image.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
A strong fluorescent response was evident as a ring shape around bacteria expressing the Ag43-FLAG tagged construct, indicating successful expression of a FLAG-tagged protein external to the membrane; red fluorescence was not observed in the cytoplasm. As expected, the negative control, expressing un-modified Ag43, did not display characteristic fluorescence pattern. Immunolabelling results let us conclude that FLAG expression is localized on the outer membrane and is accessible to anti-FLAG antibody.<br />
<br> <br />
<br> <br />
<br />
<br />
<i> c) Testing the aggregation properties of Ag43+FLAG+MCS </i><br />
<br />
<br> <br />
<br> <br />
We observed that created Ag43+FLAG+MCS construct does not aggregate in overnight cultures in contrast to the original Ag43 BioBrick (Bba_K1352000). To investigate further, overnight cultures of Ag43+FLAG+MCS and Ag43 were transferred onto sterile glass test tubes, induced with 0.2% arabinose and incubated in a shaking water bath at 37oC for >2hrs. Subsequently, test tubes were removed from the water bath and photographed for visual investigation for aggregation.<br />
<br> <br />
<br> <br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/a/a3/2001j.png"><br />
<br><br />
<font size="2">Fig.10&nbsp;&nbsp;&nbsp;&nbsp;Aggregation of Ag43 without FLAG (Bba_K1352000) (left) and Ag43+FLAG+MCS (Bba_K1352001) (right) after induction with 0.2% arabinose.<br />
<br><br />
</font><br />
</center><br />
<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br> <br />
A clear difference is visible between aggregation of two BioBricks. It seems that insertion of a FLAG tag flanked by MCS into alpha subunit of Ag43 disrupts the velcro-like mechanism of aggregation.<br />
<br><br><br />
<br />
<br />
<br />
<br />
<h3>References</h3><br />
<br />
1)&nbsp;&nbsp;&nbsp;&nbsp;Heras, B., Totsika, M., Peters, K. M., Paxman, J. J., Gee, C. L., Jarrott, R. J., & Schembri, M. A. (2014). The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping. Proceedings of the National Academy of Sciences, 111(1), 457-462.<br><br />
2)&nbsp;&nbsp;&nbsp;&nbsp;Kjærgaard, K., Schembri, M. A., Hasman, H., & Klemm, P. (2000). Antigen 43 from Escherichia coli induces inter-and intraspecies cell aggregation and changes in colony morphology of Pseudomonas fluorescens. Journal of bacteriology, 182(17), 4789-4796.<br><br />
3)&nbsp;&nbsp;&nbsp;&nbsp;Kjærgaard, K., Hasman, H., Schembri, M. A., & Klemm, P. (2002). Antigen 43-mediated autotransporter display, a versatile bacterial cell surface presentation system. Journal of bacteriology, 184(15), 4197-4204.<br><br />
4)&nbsp;&nbsp;&nbsp;&nbsp;Van der Woude, M. W., & Henderson, I. R. (2008). Regulation and function of Ag43 (flu). Annu. Rev. Microbiol., 62, 153-169.<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002Team:Aberdeen Scotland/Parts/ 20022014-10-18T02:09:06Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<br />
<br />
<h1>Ag43+FLAG+MCS(-)β-hairpins</h1><br />
<br />
<br />
<h3>Abstract</h3><br />
<br />
<p>We describe the creation of Biobrick constrct Bba_K1352002 which expresses autotransporter Ag43 with an inserted FLAG epitope tag at codon 148, flanked by multiple cloning restriction sites. Two 17 amino acids long beta hairpins were removed from Ag43 in order to eliminate native aggregation properties. We describe the design and construction of the new Biobrick, and its verification using restriction digestion and DNA sequencing. We show that removal of β-hairpins removes auto-aggregation capability of Ag43, creating a useful reagent that can be used for E. coli surface display. </p><br />
<br />
<br />
<h3>1. Structure and function</h3><br />
<br />
<p> Antigen 43 (sometimes called Ag43 or fluffing protein) is a phase-variable outer membrane protein encoded by flu gene. It is native to E.coli K12 strain and is usually expressed at about 50, 000 copies/cell. Ag34 precursor is 1039 amino acids long and subsequently becomes cleaved into alpha and beta chains (499 and 488 amino acids long respectively). The beta subunit forms a β-barrel pore via which alpha-subunit translocates to the cell surface, and with which it remains non-covalently joined. The surface alpha chain can be released by a brief heat treatment at approx. 60oC. Ag43 is an autotransporter protein, therefore it possesses all information necessary for translocation to the cell surface in its coding sequence. Ag43 mediates autoaggregation, via a velcro-like mechanism (Heras et. al., 2014), and plays a role in E.coli biofilm formation. Interestingly, the alpha subunit is able to express foreign peptide sequences on E.coli cell surface if inserted just in front of codon 148 (Kjærgaard et. al., 2002).</p><br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/2001a.png"><br><br />
<font size="2">Fig.1&nbsp;&nbsp;&nbsp;&nbsp;Graphic representation of Ag43 autotransporter structure and process of autotransportation. <br><br />
Source: Kjærgaard et. al., 2000; Van der Woude & Henderson, 2008 (modified).</font></center><br />
<br><br><br />
<br />
<br />
<br />
<br />
<h3>2. Rationale for beta-hairpins removal </h3><br />
<p> The shape of α-subunit of Ag43 resembles letter L (Fig.2). It consists of a 'β-helix domain [which forms] the stem of the letter L, followed by three rungs flanked by four β-hairpin motifs that bend the protein by about 110° and a C-terminal (...) parallel β-helix domain [which forms] the bottom of the letter L' (Heras et. al., 2014). It has been indicated that this unique shape plays a crucial role in cell-to-cell aggregation via velcro-like mechanism, in which α-subunits form a dimer by coling around each other. This interaction is strengthened by Van der Waals interactions, hydrogen bonds and salt bridges facilitated by the L-shape (Heras et. al., 2014). Recent research demonstrates that disruption of the bend and straightening of the shape by removal of two β-hairpin sequences eliminates self-association of Ag43 proteins (Heras et. al., 2014). Removal of β-hairpins does not interfere with protein translocation to the cell surface membrane.<br><br><br><br />
<center><br />
Hairpin 1 sequence&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;268&nbsp;&nbsp;&nbsp;&nbsp;AATVTGTNRLGAFSVVA&nbsp;&nbsp;&nbsp;&nbsp;284<br><br />
Hairpin 2 sequence&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;341&nbsp;&nbsp;&nbsp;&nbsp;GAAVSGTRSDGKAFSIG&nbsp;&nbsp;&nbsp;&nbsp;357<br><br><br><br />
<br />
<img src="https://static.igem.org/mediawiki/2014/5/55/2002fig2.png"><br><br />
<font size="2">Fig.2&nbsp;&nbsp;&nbsp;&nbsp;A) Graphic representation of Ag43 alpha-subunit; B) Interaction between two alpha-subunits in a velcro-like mechanism of auto-aggregation; C) Disruption of L-shape and linearization of the alpha-subunit eliminates auto-aggregation. <br><br />
Source: Heras et. al., 2014 (modified)</font></center><br />
<br><br><br />
<br />
<br />
<h3>3. Biobrick description and potential uses</h3><br />
<br />
<p> BioBrick Bba_K1352002 is a modified version of the Bba_K1352001 BioBrick. It is composed of an Ag43 coding sequence with an in-frame FLAG epitope tag flanked by BglII and HindIII multiple cloning sites inserted within the alpha-subunit in front of codon 148 of Ag43. Two β-hairpin forming sequences were removed from the Ag43 coding sequence, maintaining ORF. Expression of Ag43 is under the control of the pBAD promoter; it includes a ribosome binding site as well as two transcriptional terminators.<br><br><br />
Structure of the BioBrick was designed to allow easy insertion of foreign protein sequences of choice at codon 148 with a simple restriction digest with BglII and HindIII followed by ligation in cases where aggregation is undesirable.<br><br><br />
Potential uses of this BioBrick include surface display of foreign peptide sequences and synthetic vaccines production.<br><br></p><br />
<br />
<br />
<br />
<br />
<br />
<h3>4. Template for foreign peptide insertion</h3><br />
<br />
<br> <br />
Depending on the length, desired foreign peptide sequence can be purchased as oligos or a synthetic piece of DNA. In order to keep the foreign protein sequence in-frame, a following template should be used:<br />
<br> <br />
<br><br />
<br />
5' <i>gct gtg</i> <b>AGA TCT </b>(your sequence) <b><u>AAG CTT</b></u> <i>aac acc</i> 3' [mote reading frame of Ag43 is indicated by nucleotide triplets]<br />
<br> <br />
<br><br />
<b>BglII recognition site</b>; <b><u>HindIII recognition site</b></u>; <i>sequence adjacent to foreign peptide insertion site</i><br />
<br> <br />
<br><br />
<br><br />
<br />
<br />
<h3>5. Making of the Biobrick and plasmid modularization</h3><br />
<br> <br />
<br />
Bba_K1352001 BioBrick (Ag43+FLAG+MCS) was a starting material for this construct. Two β-hairpins were removed via In-Fusion reaction (Clonetech). For more information regarding the construction of this BioBrick please see: https://2014.igem.org/Team:Aberdeen_Scotland/Parts<br />
<br> <br />
<br> <br />
<center><br />
<img src="https://static.igem.org/mediawiki/2014/a/a8/Beta_3.png"><br />
<br> <br />
<font size="2">Fig.3&nbsp;&nbsp;&nbsp;&nbsp;Plasmid map of Bba_K1352001 BioBrick. Position of β-hairpins indicated.</font></center><br />
<br><br><br />
<br />
<br />
<br> <br />
<u>In-fusion primers used</u><br><br><br />
<br />
Removal of β-hairpin 1 (GCTGCAACCGTTACCGGCATAAACCGCCTGGGAGCATTCTCTGTTGTGGAG)<br><br />
Primer A: ATTATCAGCTTTACCCGTACTGGTAACCAGTGCGCCG <br><br />
Primer 1: GGTAAAGCTGATAATGTCGTACTGGAAAATGGCGGAC <br><br><br />
<br />
Removal of β-hairpin 2 (GGTGCCGCTGTCAGTGGTACCCGGAGCGACGGAAAGGCATTCAGTATCGGA) <br><br />
Primer 2: GGAATCGGCCAGCAGTACACCGC <br><br />
Primer B: CTGCTGGCCGATTCCGGCGGTCAGGCGGATGC<br><br />
<br><br><br />
<br />
<h3>6. Construct testing - molecular biology aspect</h3><br />
<br> <br />
<i>a) Diagnostic restriction digests</i><br />
<br />
<p>A double digest with XbaI and KpnI was performed in order to screen for clones lacking β-hairpin sequences. KpnI is a unique cutter, which recognizes G_GTAC^C sequence. It cuts uniquely within the β-hairpin 2 sequence.</p><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/e/ec/Beta_4.png"><br><br />
<font size="2">Fig.4&nbsp;&nbsp;&nbsp;&nbsp;KpnI cut site within Ag43 coding sequence.<br></font></center><br />
<br><br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/a/a2/Beta_5.png"><br><br />
<font size="2">Fig.5&nbsp;&nbsp;&nbsp;&nbsp;XbaI+KpnI digest of Bba_K1352001 (A) and Bba_K1352002 (B).<br></font></center><br />
<br><br />
<br />
<br />
<p>Bba_K1352001 was used as a control. Since it contains β-hairpin sequences, two prominent bands corresponding to 2.5 kb and 4.1 kb are present confirming presence of one XbaI and one KpnI cut sites. Clone with removed β-hairpins yield a single band, which corresponds to plasmid linearization by XbaI (6.5 kb); KpnI did not cut the plasmid, which suggests that β-hairpin 2 was removed. <br><br> In addition, a range of single and double restriction digests was carried out in order to ensure that no major indels occurred in the process of In-Fusion and created BioBrick behaves as expected and yields desired band pattern.</p><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/3/35/Beta_6.png"><br />
<br><br />
<font size="2">Fig.6&nbsp;&nbsp;&nbsp;&nbsp;Diagnostic restriction digest panel.<br />
<br><br />
</font><br />
</center><br />
<br><br />
<br />
<br />
<br />
<p>Single digests with EcoRI, XbaI, SpeI, PstI, BglII and HindIII cause a single cut within the vector and therefore result in plasmid linearization. As expected, in all cases a single band at 6.5 kB position is visible, which corresponds to the full size of a vector. </p><br />
<p>EcoRI+PstI and XbaI+SpeI result in the release of a BioBrick construct from a vector yielding two fragments of 4.5kb+2kb and 4.4kb+2.1 kb respectively.</p><br />
<p>Double digests with BglII+SpeI and HindIII+XbaI were carried out in order to confirm the presence of FLAG+MCS.</p><br />
<br />
<img src="https://static.igem.org/mediawiki/parts/8/8d/Table_1.png"><br><br><br><br />
<br />
<i>b) Confirming BioBrick Bba_K1352002 construction using DNA sequencing</i><br><br />
<p>Our Ag43+FLAG+MCS(-)β-hairpins was sequenced by the DNA Sequencing & Services Unit, Dundee University. </p><br />
<center><img src="https://static.igem.org/mediawiki/parts/1/1f/Table_2.png"><br></center><br />
<p> Sequencing primers spaced approximately every 600 bp were used to ensure good coverage. Fragments were combined together using Clustal Omega and yield a high confidence reading along the entire sequence. It confirmed the absence of two β-hairpins at expected locations; open reading frame remained unaffected. Our construct sequence was identical to that of the protein product of Bba_K1352001, with the exception of the protein sequence encoded in the β-hairpins. </p><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/c/cd/Beta_11.png"><br />
<br><br />
<font size="2">Fig.7&nbsp;&nbsp;&nbsp;&nbsp;Confirmation of the removal of β-hairpin 1. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 1 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 1 clearly visible.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/0/08/Beta_12.png"><br />
<br><br />
<font size="2">Fig.8&nbsp;&nbsp;&nbsp;&nbsp;Confirmation of the removal of β-hairpin 2. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 2 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 2 clearly visible. <br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/4/49/Beta_9.png"><br />
<br><br />
<font size="2">Fig.9&nbsp;&nbsp;&nbsp;&nbsp;Translation of: Query - Bba_K1352001; Subject - Bba_K1352002. Translation of β-hairpin sequences indicated in yellow.<br />
<br><br />
</font><br />
</center><br />
<br><br><br />
<br />
<br />
<br />
<br />
<h3>7. Testing the physiology and function of Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002)</h3><br><br />
<i>a) Testing the aggregation properties of Ag43+FLAG+MCS</i><br><br />
<p>Overnight cultures of Ag43+FLAG+MCS, Ag43+FLAG+MCS(-)β-hairpins and Ag43 were transferred onto sterile glass test tubes, induced with 0.2% arabinose and incubated in a shaking water bath at 37oC for >2hrs. Subsequently, test tubes were removed from the water bath and photographed for visual investigation for aggregation.</p><br />
<br />
<br />
<br />
<center><br />
<img src="https://static.igem.org/mediawiki/parts/c/cc/Beta_10.png"><br />
<br><br />
<font size="2">Fig.10&nbsp;&nbsp;&nbsp;&nbsp;Aggregation after induction with 0.2% arabinose of A) Ag43 without FLAG (Bba_K1352000); B) Ag43+FLAG+MCS (Bba_K1352001); Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002).<br />
<br><br />
</font><br />
</center><br />
<br />
<br />
<br />
<br />
<p>A clear difference is visible between aggregation levels of tested BioBricks. Ag43 clearly aggregates when induced with arabinose. Suprisingly, Ag43+FLAG+MCS does not display aggregation properties, even though it possesses β-hairpin sequences. We hypothesize that insertion of foreign peptide sequences, in this case FLAG tag epitope, slightly changes the shape of Ag43 at places critical for clumping and disrupts velcro-like mechanism of aggregation. Ag43+FLAG+MCS(-)β-hairpins also does not display any aggregation properties. Although we cannot confirm that this is due to removal of β-hairpin sequences and not presence of a FLAG tag epitope sequence due to lack of Ag43(-)FLAG(-)β-hairpins, literature evidence provided evidence that the lack of aggregation properties is due to removal of β-hairpins and would persist if FLAG+MCS were removed (Heras et. al., 2014).</p><br />
<p>Since the lack of aggregation properties in Bba_K1352001 may be foreign peptide sequence specific, created BioBrick Bba_K1352002 which lacks β-hairpins is still a useful construct which can be utilized in a range of projects where aggregation is undesirable. </p><br />
<p>Note: Further characterization is needed in order to determine whether removal of β-hairpin sequences does not interfere with foreign peptides expression on cell surface membrane.</p><br><br><br />
<br />
<br />
<br />
<br />
<h3>References</h3><br><br />
<br />
1)&nbsp;&nbsp;&nbsp;&nbsp;Heras, B., Totsika, M., Peters, K. M., Paxman, J. J., Gee, C. L., Jarrott, R. J., & Schembri, M. A. (2014). The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping. Proceedings of the National Academy of Sciences, 111(1), 457-462.<br><br />
2)&nbsp;&nbsp;&nbsp;&nbsp;Kjærgaard, K., Schembri, M. A., Hasman, H., & Klemm, P. (2000). Antigen 43 from Escherichia coli induces inter-and intraspecies cell aggregation and changes in colony morphology of Pseudomonas fluorescens. Journal of bacteriology, 182(17), 4789-4796.<br><br />
3)&nbsp;&nbsp;&nbsp;&nbsp;Kjærgaard, K., Hasman, H., Schembri, M. A., & Klemm, P. (2002). Antigen 43-mediated autotransporter display, a versatile bacterial cell surface presentation system. Journal of bacteriology, 184(15), 4197-4204.<br><br />
4)&nbsp;&nbsp;&nbsp;&nbsp;Van der Woude, M. W., & Henderson, I. R. (2008). Regulation and function of Ag43 (flu). Annu. Rev. Microbiol., 62, 153-169.<br><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003Team:Aberdeen Scotland/Parts/ 20032014-10-18T02:06:22Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li class="curr"><a class="curr" href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_3013">Bba_k523013</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1></h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p></p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003Team:Aberdeen Scotland/Parts/ 20032014-10-18T02:05:38Z<p>Kgizdov: Created page with "<html> <head> <!-- Charset --> <meta charset="UTF-8"> <title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title> <!-- JavaScript --> <script src="https://2014.igem.org/T..."</p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/Parts - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Background</a></li><br />
<li><a href="#">Created</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2000">Bba_K1352000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2001">Bba_K1352001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2002">Bba_K1352002</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2003">Bba_K1352003</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2004">Bba_K1352004</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2006">Bba_K1352006</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/Device">Device Data</a></li><br />
<li class="curr"><a class="curr" href="#">Improved</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9001">Bba_K759001</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_2009">Bba_K542009</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_6007">Bba_K346007</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_3013">Bba_k523013</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_0000">Bba_K1090000</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts/_9002">Bba_T9002</a></li><br />
</ul><br />
</div><br />
<br />
<!-- CONTAINER --><br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1></h1><br />
<!-- <h3></h3> --><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<p></p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/DNATeam:Aberdeen Scotland/DNA2014-10-18T01:49:21Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/DNA - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include jQuery --><br />
<script src="http://code.jquery.com/jquery-1.11.0.min.js"></script><br />
<script src="http://code.jquery.com/jquery-migrate-1.2.1.min.js"></script><br />
<br />
<!-- DNA Translator --><br />
<script src="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- DNA CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Manual scripting --><br />
<script type="text/javascript"><br />
function update() {<br />
dna = translate.toDNA({ text: $("#text_in").val() });<br />
$("#dna_out").val(dna);<br />
}<br />
<br />
function colors() {<br />
dna = $("#dna_out").val();<br />
var canvas = "";<br />
<br />
if(dna !== "") { // check for dna sequence<br />
canvas = translate.colorDNA({ text: $("#dna_out").val() });<br />
}<br />
<br />
$("#color_dna").html(canvas);<br />
}<br />
<br />
$(document).ready(<br />
function() {<br />
$("#dna_out").val("");<br />
<br />
translate = new dna({});<br />
<br />
$("#to_dna").click(update); // update DNA on button click<br />
$("#text_in").keypress( function() { // update DNA on Enter key<br />
var kcode = event.keyCode || event.which;<br />
if(kcode == 13) { //Enter keycode<br />
update();<br />
}<br />
});<br />
<br />
$("#to_color").click(colors); // create color DNA canvas<br />
}<br />
);<br />
</script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li class="curr"><a class="curr" href="#">DNA App</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Write in DNA</h1><br />
<p>DNA stands for deoxyribonucleic acid. It is the instruction material for all cells in your body. DNA is a long molecule with a double-helix structure that looks something like this:</p><br />
<img class="fl_left" src="http://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif" alt="DNA Helix"><br />
<p>"<a href="http://commons.wikimedia.org/wiki/File:ADN_animation.gif#mediaviewer/File:ADN_animation.gif">ADN animation</a>" by <a href="//en.wikipedia.org/wiki/User:Brian0918" class="extiw" title="en:User:Brian0918">brian0918</a><a href="//en.wikipedia.org/wiki/User_talk:Brian0918" class="extiw" title="en:User talk:Brian0918">™</a> - <span class="int-own-work">Own work</span>. Licensed under Public domain via <a href="//commons.wikimedia.org/wiki/">Wikimedia Commons</a>.</p><br />
<p>This looks very complicated. In order to simplify things, scientists talk about DNA in terms of the sequence of its bases. Bases are the basic building parts of DNA and they carry its information. A DNA molecule can then be characterized more easily in terms of its sequence of bases. This is called genetic sequence or genetic code.</p><br />
<p>Different genes have different sequences and those sequences determine exactly what the gene does. Some genes regulate other genes, other genes produce proteins and some genes are there for backup in case of something bad happening. So to illustrate all of this, we have created a small app that lets you convert letters, sentences and text into DNA to see how it looks.</p><br />
<p>This app will let you transcode letters, number and simple punctuation to DNA. The mapping alphabet is using the E. Coli codon bias and can translate the following characters:</p><br />
<p class="list_chars">Letters [a to z] and [A to Z], Digits [0 to 9],<br>Spaces [ ] and the Full-Stop[.]</p><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- INPUT --><br />
<div class="input_text"><br />
<p>Type in the text you wish translated to DNA in the following box:</p><br />
<textarea id="text_in" rows="2" cols="70" placeholder="Type your text here"></textarea><br />
<input id="to_dna" type="button" name="to_dna" value="Translate"><br />
<br class="clear"><br />
<p class="color_black"><sub>*You can try entering your name for instance</sub></p><br />
</div><br />
<br />
<!-- OUTPUT --><br />
<div class="output_dna"><br />
<p>The translation of your text will appear here:</p><br />
<textarea id="dna_out" rows="5" cols="70" placeholder="DNA will appear here" readonly></textarea><br />
<input id="to_color" type="button" name="to_color" value="Color Code DNA"><br />
<div id="color_dna"></div><br />
</div><br />
<br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/SocialTeam:Aberdeen Scotland/Ethics/Social2014-10-18T01:48:35Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA App</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Social</h1><br />
<h3></h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<div class="g-page" data-width="240" data-href="//plus.google.com/u/0/106825238674841642988" data-rel="publisher"></div><br />
<br />
<!-- TWITTER --><br />
<a class="twitter-timeline" width="300" height="326" href="https://twitter.com/iGEM2014ABDN" data-widget-id="522522716868333568">Tweets by @iGEM2014ABDN</a><br />
<script>!function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0],p=/^http:/.test(d.location)?'http':'https';if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src=p+"://platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");</script><br />
<br />
<br />
<!-- FACEBOOK PAGE --><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=https%3A%2F%2Fwww.facebook.com%2FiGEM2014ABDN&amp;width=200&amp;height=326&amp;colorscheme=light&amp;show_faces=true&amp;header=true&amp;stream=false&amp;show_border=true" scrolling="no" frameborder="0" style="border:none; overflow:hidden; width:200px; height:326px;" allowTransparency="true"></iframe><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/IntrospectionTeam:Aberdeen Scotland/Ethics/Introspection2014-10-18T01:48:22Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA App</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<!-- <h1></h1> --><br />
<h3>Our Simplest Guidelines for Safe Work and Ethical Practices, if you plan on working on real parasites!</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<h4>Investigating samples from patients</h4><br />
<p>As every enthusiastic scientist, since we started working on Human African Trypanosomiasis, we wanted to reach the stage where we could test blood human samples with our integrated system, to investigate its efficiency and specificity in real patients. Therefore, we started contacting experts in the field, to understand more about possible problems and to seek advice. From that perspective, World Health Organization has been one of our biggest targets. After more research, we found out that WHO targeted HAT elimination as a public health problem by 2020. Also, in 2013 WHO and the Bill and Melinda Gates Foundation signed an agreement to support innovative strategies to eliminate the disease. To support that, they set up a specimen bank containing blood, serum, cerebrospinal fluid, saliva and urine from affected and unaffected people from endemic countries from Africa.</p><br />
<br />
<h4>Acting upon it!</h4><br />
<p>We completed a <a href="https://static.igem.org/mediawiki/2014/d/db/WHO_linked.pdf">form</a> to submit it to the organization. However, our naïve expectations were soon faced with reality after consulting our idea with one of the supervisors, Dr Berndt Muller, who further evaluated it with Aberdeen University Safety Committee. Unfortunately, we did not have the necessary training or the vaccinations required to work with real antigens. Even more, that could have exposed us to risk of infections, had we not checked it with qualified personnel before.</p><br />
<br />
<h4>Different approach</h4><br />
<p>Even though we felt disappointed, this experience taught us that ethical and safety issues are the basis of any scientific project and only by addressing those issues first, you can then be free to tackle the real scientific challenges. Our different approach was to design the project in the direction of a proof-of-concept idea and to find different ways through which we could get our project to the stage of a more real-life based assay and characterisation. Therfore, we did more literature research and contacted immediately two experts in the field of Human African Trypanosomiasis, Dr. Philippe Büscher, Head of the Unit of Parasite Diagnostics at Institute of Tropical Medicine Antwerp and Liesbeth Van Nieuwenhove, PhD Biology & Veterinarian. After explaining our project to them, we kindly asked them if they could provide us with antibodies against the most common trypanosomal antigens, VSG 1.3 and 1.5. They have been extremely understanding and helpful and they even sent more samples that we asked for, to allow us to test our novel trypanosomal detector. Thank you!</p><br />
<p>Unfortunately, 10 weeks did not allow us to test those tryapanosomal antibodies, as we wanted. Frustrating enough, we have both the mimotopes for trypanosomes and the antibodies provided in the -80°C freezer, waiting for a future Aberdeen Team to be tested.</p><br />
<br />
<h4>Influence on our project and advice for other iGEM teams</h4><br />
<p>We realized that our initial, enthusiastic plan of working with real trypanosome pathogens in the laboratory was not achievable, but we could say that it helped us develop a novel approach to tackle the same problem without any safety and ethical concern, by getting in contact with researchers that work on the disease, who are more than keen to offer help to undergraduates.</p><br />
<br />
<p>Moreover, we realized that people’s fear for synthetic biology and genetic engineering sometimes expands beyond boundaries. Mass populations fear the evolvement of deadly viruses and random cloning, due to poor understanding of synthetic biology and scientific achievements. Therefore, we aimed to educate the public and we targeted different audiences: general public-short radio interview; more specialized public-publishing Blogposts on the Aberdeen University magazine website and giving a short presentation for the Explorathon European Researchers’ Night. Moreover, we presented our project both at the beginning and the end of the summer, by going to the iGEM Scottish Team Meeting and Synthetic Biology Conference in Edinburgh, respectively to Professor Muffy Calder, Chief Scientific Adviser for Scotland, at The Royal Society of Edinburgh. We also created an interactive DNA translating device, which could be used by a 10 year-old and we used social media (Facebook, Twitter and Goggle+ account) to advertise our project, iGEM and synthetic biology.</p><br />
<br />
<p>We encourage further iGEM teams to never give up on their project idea, because there are always safe and novel ways through which they can address it. Where there is a will, there is a way!</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/EthicsTeam:Aberdeen Scotland/Ethics2014-10-18T01:48:09Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA App</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1></h1><br />
<h3>Our part in helping to develop Scottish national science policy in the area of synthetic biology</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<p>The Aberdeen team was fortunate to be able to accept an invitation to an event on 16th October organised by the Chief Scientific Advisor of Scotland, Prof Muffy<br />
Calder. Prof. Calder is a Scottish government-appointed scientist whose role is to advise the Scottish government on science issues as they impact on government<br />
policy.</p><br />
<br />
<p>Prof. Calder co-chairs the <a href="http://www.scottishscience.org.uk/">Scottish Scientific Advisory Council (SSAC)</a>, an government body providing scientific<br />
advice to government, and currently engaged with producing a report on the future development of synthetic biology as a tool for biotechnology in Scotland. We, the<br />
Aberdeen iGEM team were invited to the launch event for the SSAC Report on Synthetic biology: opportunities for Scotland, where we were asked to present a poster on<br />
our iGEM project to evidence the development of synthetic biology in Scotland. We had the opportunity to speak to a number of key figures in this area, including<br />
Prof Calder, and Prof. Nigel Brown, President of the Society for General Microbiology and co-author of the report. We considered that we had contributed in some<br />
small way to the development of synthetic biology policy, and were participants in the process of development of national science policy in this area. We regarded<br />
ourselves as privileged to see how national science policies, including those on synthetic biology are developed in our country, as well as to be able to speak to<br />
Scottish policy makers at the event.</p><br />
<br />
<p>The Scottish SSAC report on Synthetic biology: opportunities for Scotland: A report by the Scottish Science Advisory Council will be published on 17th September<br />
2014.</p><br />
<br />
<div class="float"><a href="http://www.scottishscience.org.uk/"><img src="https://static.igem.org/mediawiki/2014/9/90/SSAClogo.png"></a></div><br />
<br />
<h4>iGEM Aberdeen: public outreach and science communication</h4><br />
<p>The Aberdeen team used a number of outreach opportunities to engage with non-scientists and the general public. Each provided the opportunity to engage with a lay<br />
audience, and find out what the public thinks of the science of synthetic biology. We discussed our science and presented at the following events.</p><br />
<br />
<p><b>SCHMU Radio, Aberdeen:</b> our team was interviewed on the SHMU local radio station for 20 minutes on the Talking Science show, giving us the chance to<br />
communicate our project, and the concept of synthetic biology, to an audience in the Aberdeen city area.</p><br />
<br />
<audio controls><br />
<source src="https://static.igem.org/mediawiki/2014/f/f2/Joe_Radio.mp3" type="audio/mpeg"><br />
Your browser does not support the audio element.<br />
</audio><br />
<br />
<p><b>Explorathon 2014:</b> this annual European event is a vast science public outreach event giving researchers from across Europe the chance to showcase their<br />
science to a general public audience. On <a href="http://www.explorathon.co.uk/aberdeen">Explorathon day</a> (26th September 2014), our contribution was present to<br />
an open audience in a quick-fire Pecha Kucha event (20 slides, 20 seconds each) held in the Belmont cinema in Aberdeen city centre. This open event was attended by a<br />
large number of members of the public, followed by a Q&A session.</p><br />
<br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3qMgndUmz_Q" frameborder="0" allowfullscreen></iframe><br />
<br />
<p><b>iGEM project blog with <a href="http://www.aumag.co.uk/">AU Magazine</a>:</b> our team had a great opportunity to engage with non-scientists through a 3-part<br />
blog we produced in the Aberdeen University science magazine 'Au'. This magazine is written for a non-scientific audience, providing an important outreach<br />
opportunity.</p><br />
<br />
<h5>Our goal for publishing a series of articles was to:</h5><br />
<ul><br />
<li><br />
<ul style="list-style-type:disc"><br />
<li>Address the general public's misconceptions surrounding synthetic biology</li><br />
<li>Popularise SynBio</li><br />
<li>Get people thinking about how synthetic biology can provide solutions to serious global issues we face nowadays</li><br />
<li>To start a discussion about the ethical implication of our actions; Our moral responsibility to use knowledge to do good, as well as looking at the<br />
sustainability of synthetic biology in the future</li><br />
<li>To popularize iGEM</li><br />
<li>To inspire readers of the magazine (fellow students) and show that young people can make a positive contribution and tackle global problems</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<h4>To date we have published 2 articles:</h4><br />
<ul><br />
<li><br />
<h5><b><a href="https://static.igem.org/mediawiki/2014/9/9e/A_Young_Physicist.pdf">A Young Physicist’s perspective on Synthetic Biology</a></b>, in which we<br />
addressed the following:</h5><br />
<ul><br />
<li>- What is iGEM</li><br />
<li>- What is synthetic biology, emphasizing its interdisciplinary aspect and debunking myths surrounding 'the Frankenstein's biology'</li><br />
<li>- Why are physicists involved in biology projects? How the modelling can guide informed design of biological research</li><br />
<li>- The unlimited potential of synbio and how we implement it in everyday life</li><br />
<li>- The risks and ethical implications connected with irresponsible applications of synbio, and how it is tackled by laws and regulations</li><br />
</ul><br />
</li><br />
<li><br />
<h5><a href="https://static.igem.org/mediawiki/2014/a/a4/IGEM-Blogpost_2.pdf"><b>Wake up to the sleeping sickness!</b></a>, our grand plan to engineer an E. coli<br />
System for the diagnosis of neglected tropical diseases:</h5><br />
<ul><br />
<li>- What is Human African Trypanosomiasis (HAT)</li><br />
<li>- The burden of the disease</li><br />
<li>- Difficulties with diagnosing HAT</li><br />
<li>- How to engineer a diagnostic system adapted to function effectively in remote parts of Africa and how synthetic biology enables us to do so</li><br />
<li>- The solution - our E.coli operated diagnosis system and a HAT detector device</li><br />
<li>- The positive impact of our project</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<p>Our third article about the Giant iGEM Jamboree and an exchange of ideas within an international scientific community will be published in mid-November. We will<br />
emphasize the international aspect of the competition and how all teams work together to perform high quality, safe science.</p><br />
<br />
<h4>Interactions with the Scottish Health Service</h4><br />
<p>In addition to the above outreach, as part of the project planning we also contacted a nearby National Health Service lab (Ms Leslie Bevridge, Grampian health<br />
authority Microbiology pathology lab) to identify possible disease targets for a new diagnosis tool. While we eventually settled on tropical disease diagnosis in<br />
remote areas we were still periodically in contact throughout the project, often regarding our weekly progress.</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/DNATeam:Aberdeen Scotland/DNA2014-10-18T01:44:43Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/DNA - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include jQuery --><br />
<script src="http://code.jquery.com/jquery-1.11.0.min.js"></script><br />
<script src="http://code.jquery.com/jquery-migrate-1.2.1.min.js"></script><br />
<br />
<!-- DNA Translator --><br />
<script src="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- DNA CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Manual scripting --><br />
<script type="text/javascript"><br />
function update() {<br />
dna = translate.toDNA({ text: $("#text_in").val() });<br />
$("#dna_out").val(dna);<br />
}<br />
<br />
function colors() {<br />
dna = $("#dna_out").val();<br />
var canvas = "";<br />
<br />
if(dna !== "") { // check for dna sequence<br />
canvas = translate.colorDNA({ text: $("#dna_out").val() });<br />
}<br />
<br />
$("#color_dna").html(canvas);<br />
}<br />
<br />
$(document).ready(<br />
function() {<br />
$("#dna_out").val("");<br />
<br />
translate = new dna({});<br />
<br />
$("#to_dna").click(update); // update DNA on button click<br />
$("#text_in").keypress( function() { // update DNA on Enter key<br />
var kcode = event.keyCode || event.which;<br />
if(kcode == 13) { //Enter keycode<br />
update();<br />
}<br />
});<br />
<br />
$("#to_color").click(colors); // create color DNA canvas<br />
}<br />
);<br />
</script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li class="curr"><a class="curr" href="#">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Write in DNA</h1><br />
<p>DNA stands for deoxyribonucleic acid. It is the instruction material for all cells in your body. DNA is a long molecule with a double-helix structure that looks something like this:</p><br />
<img class="fl_left" src="http://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif" alt="DNA Helix"><br />
<p>"<a href="http://commons.wikimedia.org/wiki/File:ADN_animation.gif#mediaviewer/File:ADN_animation.gif">ADN animation</a>" by <a href="//en.wikipedia.org/wiki/User:Brian0918" class="extiw" title="en:User:Brian0918">brian0918</a><a href="//en.wikipedia.org/wiki/User_talk:Brian0918" class="extiw" title="en:User talk:Brian0918">™</a> - <span class="int-own-work">Own work</span>. Licensed under Public domain via <a href="//commons.wikimedia.org/wiki/">Wikimedia Commons</a>.</p><br />
<p>This looks very complicated. In order to simplify things, scientists talk about DNA in terms of the sequence of its bases. Bases are the basic building parts of DNA and they carry its information. A DNA molecule can then be characterized more easily in terms of its sequence of bases. This is called genetic sequence or genetic code.</p><br />
<p>Different genes have different sequences and those sequences determine exactly what the gene does. Some genes regulate other genes, other genes produce proteins and some genes are there for backup in case of something bad happening. So to illustrate all of this, we have created a small app that lets you convert letters, sentences and text into DNA to see how it looks.</p><br />
<p>This app will let you transcode letters, number and simple punctuation to DNA. The mapping alphabet is using the E. Coli codon bias and can translate the following characters:</p><br />
<p class="list_chars">Letters [a to z] and [A to Z], Digits [0 to 9],<br>Spaces [ ] and the Full-Stop[.]</p><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- INPUT --><br />
<div class="input_text"><br />
<p>Type in the text you wish translated to DNA in the following box:</p><br />
<textarea id="text_in" rows="2" cols="70" placeholder="Type your text here"></textarea><br />
<input id="to_dna" type="button" name="to_dna" value="Translate"><br />
<br class="clear"><br />
<p class="color_black"><sub>*You can try entering your name for instance</sub></p><br />
</div><br />
<br />
<!-- OUTPUT --><br />
<div class="output_dna"><br />
<p>The translation of your text will appear here:</p><br />
<textarea id="dna_out" rows="5" cols="70" placeholder="DNA will appear here" readonly></textarea><br />
<input id="to_color" type="button" name="to_color" value="Color Code DNA"><br />
<div id="color_dna"></div><br />
</div><br />
<br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/DNATeam:Aberdeen Scotland/DNA2014-10-18T01:44:21Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/DNA - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include jQuery --><br />
<script src="http://code.jquery.com/jquery-1.11.0.min.js"></script><br />
<script src="http://code.jquery.com/jquery-migrate-1.2.1.min.js"></script><br />
<br />
<!-- DNA Translator --><br />
<script src="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- DNA CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Manual scripting --><br />
<script type="text/javascript"><br />
function update() {<br />
dna = translate.toDNA({ text: $("#text_in").val() });<br />
$("#dna_out").val(dna);<br />
}<br />
<br />
function colors() {<br />
dna = $("#dna_out").val();<br />
var canvas = "";<br />
<br />
if(dna !== "") { // check for dna sequence<br />
canvas = translate.colorDNA({ text: $("#dna_out").val() });<br />
}<br />
<br />
$("#color_dna").html(canvas);<br />
}<br />
<br />
$(document).ready(<br />
function() {<br />
$("#dna_out").val("");<br />
<br />
translate = new dna({});<br />
<br />
$("#to_dna").click(update); // update DNA on button click<br />
$("#text_in").keypress( function() { // update DNA on Enter key<br />
var kcode = event.keyCode || event.which;<br />
if(kcode == 13) { //Enter keycode<br />
update();<br />
}<br />
});<br />
<br />
$("#to_color").click(colors); // create color DNA canvas<br />
}<br />
);<br />
</script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li class="curr"><a class="curr" href="#">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Write in DNA</h1><br />
<p>DNA stands for deoxyribonucleic acid. It is the instruction material for all cells in your body. DNA is a long molecule with a double-helix structure that looks something like this:</p><br />
<img class="fl_left" src="http://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif" alt="DNA Helix"><br />
<p>"<a href="http://commons.wikimedia.org/wiki/File:ADN_animation.gif#mediaviewer/File:ADN_animation.gif">ADN animation</a>" by <a href="//en.wikipedia.org/wiki/User:Brian0918" class="extiw" title="en:User:Brian0918">brian0918</a><a href="//en.wikipedia.org/wiki/User_talk:Brian0918" class="extiw" title="en:User talk:Brian0918">™</a> - <span class="int-own-work">Own work</span>. Licensed under Public domain via <a href="//commons.wikimedia.org/wiki/">Wikimedia Commons</a>.</p><br />
<p>This looks very complicated. In order to simplify things, scientists talk about DNA in terms of the sequence of its bases. Bases are the basic building parts of DNA and they carry its information. A DNA molecule can then be characterized more easily in terms of its sequence of bases. This is called genetic sequence or genetic code.</p><br />
<p>Different genes have different sequences and those sequences determine exactly what the gene does. Some genes regulate other genes, other genes produce proteins and some genes are there for backup in case of something bad happening. So to illustrate all of this, we have created a small app that lets you convert letters, sentences and text into DNA to see how it looks.</p><br />
<p>This app will let you transcode letters, number and simple punctuation to DNA. The mapping alphabet is using the E. Coli codon bias and can translate the following characters:</p><br />
<p class="list_chars">Letters [a to z] and [A to Z], Digits [0 to 9],<br>Spaces [ ] and the Full-Stop[.]</p><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- INPUT --><br />
<div class="input_text"><br />
<p>Type in the text you wish translated to DNA in the following box:</p><br />
<textarea id="text_in" rows="2" cols="70" placeholder="Type your text here"></textarea><br />
<input id="to_dna" type="button" name="to_dna" value="Translate"><br />
<br class="clear"><br />
<p class="color_black"><sub>*You can try entering your name for instance</sub></p><br />
</div><br />
<br />
<!-- OUTPUT --><br />
<div class="output_dna"><br />
<p>The translation of your text will appear here:</p><br />
<textarea id="dna_out" rows="5" cols="70" placeholder="DNA will appear here" readonly></textarea><br />
<input id="to_color" type="button" name="to_color" value="Color Code DNA"><br />
<div id="color_dna"></div><br />
</div><br />
<br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/DNATeam:Aberdeen Scotland/DNA2014-10-18T01:43:56Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland/DNA - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include jQuery --><br />
<script src="http://code.jquery.com/jquery-1.11.0.min.js"></script><br />
<script src="http://code.jquery.com/jquery-migrate-1.2.1.min.js"></script><br />
<br />
<!-- DNA Translator --><br />
<script src="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- DNA CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Manual scripting --><br />
<script type="text/javascript"><br />
function update() {<br />
dna = translate.toDNA({ text: $("#text_in").val() });<br />
$("#dna_out").val(dna);<br />
}<br />
<br />
function colors() {<br />
dna = $("#dna_out").val();<br />
var canvas = "";<br />
<br />
if(dna !== "") { // check for dna sequence<br />
canvas = translate.colorDNA({ text: $("#dna_out").val() });<br />
}<br />
<br />
$("#color_dna").html(canvas);<br />
}<br />
<br />
$(document).ready(<br />
function() {<br />
$("#dna_out").val("");<br />
<br />
translate = new dna({});<br />
<br />
$("#to_dna").click(update); // update DNA on button click<br />
$("#text_in").keypress( function() { // update DNA on Enter key<br />
var kcode = event.keyCode || event.which;<br />
if(kcode == 13) { //Enter keycode<br />
update();<br />
}<br />
});<br />
<br />
$("#to_color").click(colors); // create color DNA canvas<br />
}<br />
);<br />
</script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li class="curr"><a class="curr" href="#">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Write in DNA</h1><br />
<p>DNA stands for deoxyribonucleic acid. It is the instruction material for all cells in your body. DNA is a long molecule with a double-helix structure that looks something like this:</p><br />
<img class="fl_left" src="http://upload.wikimedia.org/wikipedia/commons/8/81/ADN_animation.gif" alt="DNA Helix"><br />
<p>"<a href="http://commons.wikimedia.org/wiki/File:ADN_animation.gif#mediaviewer/File:ADN_animation.gif">ADN animation</a>" by <a href="//en.wikipedia.org/wiki/User:Brian0918" class="extiw" title="en:User:Brian0918">brian0918</a><a href="//en.wikipedia.org/wiki/User_talk:Brian0918" class="extiw" title="en:User talk:Brian0918">™</a> - <span class="int-own-work">Own work</span>. Licensed under Public domain via <a href="//commons.wikimedia.org/wiki/">Wikimedia Commons</a>.</p><br />
<p>This looks very complicated. In order to simplify things, scientists talk about DNA in terms of the sequence of its bases. Bases are the basic building parts of DNA and they carry its information. A DNA molecule can then be characterized more easily in terms of its sequence of bases. This is called genetic sequence or genetic code.</p><br />
<p>Different genes have different sequences and those sequences determine exactly what the gene does. Some genes regulate other genes, other genes produce proteins and some genes are there for backup in case of something bad happening. So to illustrate all of this, we have created a small app that lets you convert letters, sentences and text into DNA to see how it looks.</p><br />
<p>This app will let you transcode letters, number and simple punctuation to DNA. The mapping alphabet is using the E. Coli codon bias and can translate the following characters:</p><br />
<p class="list_chars">Letters [a to z] and [A to Z], Digits [0 to 9],<br>Spaces [ ] and the Full-Stop[.]</p><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- INPUT --><br />
<div class="input_text"><br />
<p>Type in the text you wish translated to DNA in the following box:</p><br />
<textarea id="text_in" rows="2" cols="70" placeholder="Type your text here"></textarea><br />
<input id="to_dna" type="button" name="to_dna" value="Translate"><br />
<br class="clear"><br />
<p class="color_black"><sub>*You can try entering your name for instance</sub></p><br />
</div><br />
<br />
<!-- OUTPUT --><br />
<div class="output_dna"><br />
<p>The translation of your text will appear here:</p><br />
<textarea id="dna_out" rows="5" cols="70" placeholder="DNA will appear here" readonly></textarea><br />
<input id="to_color" type="button" name="to_color" value="Color Code DNA"><br />
<div id="color_dna"></div><br />
</div><br />
<br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/SocialTeam:Aberdeen Scotland/Ethics/Social2014-10-18T01:43:17Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Social</h1><br />
<h3></h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<div class="g-page" data-width="240" data-href="//plus.google.com/u/0/106825238674841642988" data-rel="publisher"></div><br />
<br />
<!-- TWITTER --><br />
<a class="twitter-timeline" width="300" height="326" href="https://twitter.com/iGEM2014ABDN" data-widget-id="522522716868333568">Tweets by @iGEM2014ABDN</a><br />
<script>!function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0],p=/^http:/.test(d.location)?'http':'https';if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src=p+"://platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");</script><br />
<br />
<br />
<!-- FACEBOOK PAGE --><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=https%3A%2F%2Fwww.facebook.com%2FiGEM2014ABDN&amp;width=200&amp;height=326&amp;colorscheme=light&amp;show_faces=true&amp;header=true&amp;stream=false&amp;show_border=true" scrolling="no" frameborder="0" style="border:none; overflow:hidden; width:200px; height:326px;" allowTransparency="true"></iframe><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/IntrospectionTeam:Aberdeen Scotland/Ethics/Introspection2014-10-18T01:42:49Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<!-- <h1></h1> --><br />
<h3>Our Simplest Guidelines for Safe Work and Ethical Practices, if you plan on working on real parasites!</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<h4>Investigating samples from patients</h4><br />
<p>As every enthusiastic scientist, since we started working on Human African Trypanosomiasis, we wanted to reach the stage where we could test blood human samples with our integrated system, to investigate its efficiency and specificity in real patients. Therefore, we started contacting experts in the field, to understand more about possible problems and to seek advice. From that perspective, World Health Organization has been one of our biggest targets. After more research, we found out that WHO targeted HAT elimination as a public health problem by 2020. Also, in 2013 WHO and the Bill and Melinda Gates Foundation signed an agreement to support innovative strategies to eliminate the disease. To support that, they set up a specimen bank containing blood, serum, cerebrospinal fluid, saliva and urine from affected and unaffected people from endemic countries from Africa.</p><br />
<br />
<h4>Acting upon it!</h4><br />
<p>We completed a <a href="https://static.igem.org/mediawiki/2014/d/db/WHO_linked.pdf">form</a> to submit it to the organization. However, our naïve expectations were soon faced with reality after consulting our idea with one of the supervisors, Dr Berndt Muller, who further evaluated it with Aberdeen University Safety Committee. Unfortunately, we did not have the necessary training or the vaccinations required to work with real antigens. Even more, that could have exposed us to risk of infections, had we not checked it with qualified personnel before.</p><br />
<br />
<h4>Different approach</h4><br />
<p>Even though we felt disappointed, this experience taught us that ethical and safety issues are the basis of any scientific project and only by addressing those issues first, you can then be free to tackle the real scientific challenges. Our different approach was to design the project in the direction of a proof-of-concept idea and to find different ways through which we could get our project to the stage of a more real-life based assay and characterisation. Therfore, we did more literature research and contacted immediately two experts in the field of Human African Trypanosomiasis, Dr. Philippe Büscher, Head of the Unit of Parasite Diagnostics at Institute of Tropical Medicine Antwerp and Liesbeth Van Nieuwenhove, PhD Biology & Veterinarian. After explaining our project to them, we kindly asked them if they could provide us with antibodies against the most common trypanosomal antigens, VSG 1.3 and 1.5. They have been extremely understanding and helpful and they even sent more samples that we asked for, to allow us to test our novel trypanosomal detector. Thank you!</p><br />
<p>Unfortunately, 10 weeks did not allow us to test those tryapanosomal antibodies, as we wanted. Frustrating enough, we have both the mimotopes for trypanosomes and the antibodies provided in the -80°C freezer, waiting for a future Aberdeen Team to be tested.</p><br />
<br />
<h4>Influence on our project and advice for other iGEM teams</h4><br />
<p>We realized that our initial, enthusiastic plan of working with real trypanosome pathogens in the laboratory was not achievable, but we could say that it helped us develop a novel approach to tackle the same problem without any safety and ethical concern, by getting in contact with researchers that work on the disease, who are more than keen to offer help to undergraduates.</p><br />
<br />
<p>Moreover, we realized that people’s fear for synthetic biology and genetic engineering sometimes expands beyond boundaries. Mass populations fear the evolvement of deadly viruses and random cloning, due to poor understanding of synthetic biology and scientific achievements. Therefore, we aimed to educate the public and we targeted different audiences: general public-short radio interview; more specialized public-publishing Blogposts on the Aberdeen University magazine website and giving a short presentation for the Explorathon European Researchers’ Night. Moreover, we presented our project both at the beginning and the end of the summer, by going to the iGEM Scottish Team Meeting and Synthetic Biology Conference in Edinburgh, respectively to Professor Muffy Calder, Chief Scientific Adviser for Scotland, at The Royal Society of Edinburgh. We also created an interactive DNA translating device, which could be used by a 10 year-old and we used social media (Facebook, Twitter and Goggle+ account) to advertise our project, iGEM and synthetic biology.</p><br />
<br />
<p>We encourage further iGEM teams to never give up on their project idea, because there are always safe and novel ways through which they can address it. Where there is a will, there is a way!</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/EthicsTeam:Aberdeen Scotland/Ethics2014-10-18T01:42:34Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1></h1><br />
<h3>Our part in helping to develop Scottish national science policy in the area of synthetic biology</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<p>The Aberdeen team was fortunate to be able to accept an invitation to an event on 16th October organised by the Chief Scientific Advisor of Scotland, Prof Muffy<br />
Calder. Prof. Calder is a Scottish government-appointed scientist whose role is to advise the Scottish government on science issues as they impact on government<br />
policy.</p><br />
<br />
<p>Prof. Calder co-chairs the <a href="http://www.scottishscience.org.uk/">Scottish Scientific Advisory Council (SSAC)</a>, an government body providing scientific<br />
advice to government, and currently engaged with producing a report on the future development of synthetic biology as a tool for biotechnology in Scotland. We, the<br />
Aberdeen iGEM team were invited to the launch event for the SSAC Report on Synthetic biology: opportunities for Scotland, where we were asked to present a poster on<br />
our iGEM project to evidence the development of synthetic biology in Scotland. We had the opportunity to speak to a number of key figures in this area, including<br />
Prof Calder, and Prof. Nigel Brown, President of the Society for General Microbiology and co-author of the report. We considered that we had contributed in some<br />
small way to the development of synthetic biology policy, and were participants in the process of development of national science policy in this area. We regarded<br />
ourselves as privileged to see how national science policies, including those on synthetic biology are developed in our country, as well as to be able to speak to<br />
Scottish policy makers at the event.</p><br />
<br />
<p>The Scottish SSAC report on Synthetic biology: opportunities for Scotland: A report by the Scottish Science Advisory Council will be published on 17th September<br />
2014.</p><br />
<br />
<div class="float"><a href="http://www.scottishscience.org.uk/"><img src="https://static.igem.org/mediawiki/2014/9/90/SSAClogo.png"></a></div><br />
<br />
<h4>iGEM Aberdeen: public outreach and science communication</h4><br />
<p>The Aberdeen team used a number of outreach opportunities to engage with non-scientists and the general public. Each provided the opportunity to engage with a lay<br />
audience, and find out what the public thinks of the science of synthetic biology. We discussed our science and presented at the following events.</p><br />
<br />
<p><b>SCHMU Radio, Aberdeen:</b> our team was interviewed on the SHMU local radio station for 20 minutes on the Talking Science show, giving us the chance to<br />
communicate our project, and the concept of synthetic biology, to an audience in the Aberdeen city area.</p><br />
<br />
<audio controls><br />
<source src="https://static.igem.org/mediawiki/2014/f/f2/Joe_Radio.mp3" type="audio/mpeg"><br />
Your browser does not support the audio element.<br />
</audio><br />
<br />
<p><b>Explorathon 2014:</b> this annual European event is a vast science public outreach event giving researchers from across Europe the chance to showcase their<br />
science to a general public audience. On <a href="http://www.explorathon.co.uk/aberdeen">Explorathon day</a> (26th September 2014), our contribution was present to<br />
an open audience in a quick-fire Pecha Kucha event (20 slides, 20 seconds each) held in the Belmont cinema in Aberdeen city centre. This open event was attended by a<br />
large number of members of the public, followed by a Q&A session.</p><br />
<br />
<iframe width="560" height="315" src="//www.youtube.com/embed/3qMgndUmz_Q" frameborder="0" allowfullscreen></iframe><br />
<br />
<p><b>iGEM project blog with <a href="http://www.aumag.co.uk/">AU Magazine</a>:</b> our team had a great opportunity to engage with non-scientists through a 3-part<br />
blog we produced in the Aberdeen University science magazine 'Au'. This magazine is written for a non-scientific audience, providing an important outreach<br />
opportunity.</p><br />
<br />
<h5>Our goal for publishing a series of articles was to:</h5><br />
<ul><br />
<li><br />
<ul style="list-style-type:disc"><br />
<li>Address the general public's misconceptions surrounding synthetic biology</li><br />
<li>Popularise SynBio</li><br />
<li>Get people thinking about how synthetic biology can provide solutions to serious global issues we face nowadays</li><br />
<li>To start a discussion about the ethical implication of our actions; Our moral responsibility to use knowledge to do good, as well as looking at the<br />
sustainability of synthetic biology in the future</li><br />
<li>To popularize iGEM</li><br />
<li>To inspire readers of the magazine (fellow students) and show that young people can make a positive contribution and tackle global problems</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<h4>To date we have published 2 articles:</h4><br />
<ul><br />
<li><br />
<h5><b><a href="https://static.igem.org/mediawiki/2014/9/9e/A_Young_Physicist.pdf">A Young Physicist’s perspective on Synthetic Biology</a></b>, in which we<br />
addressed the following:</h5><br />
<ul><br />
<li>- What is iGEM</li><br />
<li>- What is synthetic biology, emphasizing its interdisciplinary aspect and debunking myths surrounding 'the Frankenstein's biology'</li><br />
<li>- Why are physicists involved in biology projects? How the modelling can guide informed design of biological research</li><br />
<li>- The unlimited potential of synbio and how we implement it in everyday life</li><br />
<li>- The risks and ethical implications connected with irresponsible applications of synbio, and how it is tackled by laws and regulations</li><br />
</ul><br />
</li><br />
<li><br />
<h5><a href="https://static.igem.org/mediawiki/2014/a/a4/IGEM-Blogpost_2.pdf"><b>Wake up to the sleeping sickness!</b></a>, our grand plan to engineer an E. coli<br />
System for the diagnosis of neglected tropical diseases:</h5><br />
<ul><br />
<li>- What is Human African Trypanosomiasis (HAT)</li><br />
<li>- The burden of the disease</li><br />
<li>- Difficulties with diagnosing HAT</li><br />
<li>- How to engineer a diagnostic system adapted to function effectively in remote parts of Africa and how synthetic biology enables us to do so</li><br />
<li>- The solution - our E.coli operated diagnosis system and a HAT detector device</li><br />
<li>- The positive impact of our project</li><br />
</ul><br />
</li><br />
</ul><br />
<br />
<p>Our third article about the Giant iGEM Jamboree and an exchange of ideas within an international scientific community will be published in mid-November. We will<br />
emphasize the international aspect of the competition and how all teams work together to perform high quality, safe science.</p><br />
<br />
<h4>Interactions with the Scottish Health Service</h4><br />
<p>In addition to the above outreach, as part of the project planning we also contacted a nearby National Health Service lab (Ms Leslie Bevridge, Grampian health<br />
authority Microbiology pathology lab) to identify possible disease targets for a new diagnosis tool. While we eventually settled on tropical disease diagnosis in<br />
remote areas we were still periodically in contact throughout the project, often regarding our weekly progress.</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_ScotlandTeam:Aberdeen Scotland2014-10-18T01:42:03Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland">Overview</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Aberdeen iGEM Team 2014</h1><br />
<h3>Wake up to the Sleeping Sickness</h3><br />
<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Igem_logo_exp.png"><br />
<br><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<p>Trypanosoma brucei gambiense, the causative agent of Human African Trypanosomiasis (HAT) (commonly known as African Sleeping Sickness), infects 30,000 people<br />
worldwide, with 60 million at disease risk. Unrecognised, this disease is fatal, but accurate diagnosis, relying on detection of patient serum antibodies against two<br />
different trypanosomal antigens, Variable Surface Glycoprotein LiTat 1.3 and Variable Surface Glycoprotein LiTat 1.5, allows successful treatment.</p><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/Parasite.png"><br />
<h3>Our project and achievements</h3><br />
<p>We engineered autotransporters Antigen43 (Ag43) and Ice-Nucleation protein (INP) to successfully express surface epitopes in <i>E.coli</i>, that mimic the two different<br />
trypanosomal antigens. Therefore, we created standardised and user-friendly Ag43 and INP BioBricks ready for peptides of choice to be cloned in. Two <i>E.coli</i> strains<br />
were generated, each expressing a distinct surface epitope and either a quorum sensing sender or receiver module respectively. We delivered a proof-of-principle<br />
demonstration of our project, by showing that the quorum-based system is capable of detecting cell surface Ag43-FLAG ‘Receiver’ <i>E.coli</i> in an anti-FLAG bead pull-<br />
down. These ‘Receivers’ co-cultured with AHL-synthesising ‘Senders’ produced a strong –FLAG-tag dependent, AHL-inducible GFP response. This system if applied in a<br />
real life scenario could effectively diagnose a neglected tropical disease such as Trypanosomiasis, using patient serum-derived antibodies, with minimal facilities.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Diag.png"><br><br />
<h3>The user-friendly, portable, inexpensive GFP detection device</h3><br />
<p>We constructed a cheap, Raspberry Pi computer-controlled fluorimeter suitable for developing countries, showing it could detect QS fluorescence output. The<br />
detection device costs around $100 and could replace heavy and expensive microscopes, to make the detection system affordable to remote populations in Africa.</p><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/GFP_detector.png"><br />
<h3>Novel applications</h3><br />
<p>This novel application to diagnose patient exposure to tropical pathogens integrates antigen display and quorum sensing to implement AND logic sensing. It<br />
facilitates cheap, simple diagnosis of neglected tropical diseases such as HAT. Future diagnosis kits can be constructed and modularized using the cheap and self-<br />
replenishing <i>E. coli</i> based detection system we created as a platform for displaying two different mimotopes. Mimotopes are shortened versions of real epitopes<br />
identified for a panel of diseases, all of which are currently stored in a universal database, available to everyone and known as MimoDB [http://immunet.cn/mimodb].<br />
Moreover, it was recently shown that upon heat-treatment of Ag43 autotransporter-foreign peptide complex at 60°C, a chimeric form of the expressed foreign protein<br />
can be isolated and remain fully active. The chimeric protein was then used to induce an immune response and to develop a novel vaccine for cancer therapy (Huang et<br />
al., 2014). Therefore, we suggest that further research can be done on Ag43-trypanosomal mimotope/ other mimotope complexes for a potential first vaccine for HAT/<br />
other diseases.</p><br />
<p><b>Reference:</b> Huang, F., Li, L., Liu, Q., Li, Y., Bai, R., Huang, Y., Zhao, H., Guo, J., Zhou, S., Wang, H. and others, (2014). Bacterial surface display of<br />
endoglin by antigen 43 induces antitumor effectiveness via bypassing immunotolerance and inhibition of angiogenesis. International Journal of Cancer, 134(8),<br />
pp.1981--1990.</p><br />
</div><br />
<br />
<div class="external"><br />
<p>You can find our official iGEM Registry Page <a href="https://igem.org/Team.cgi?year=2014&team_name=Aberdeen_Scotland">here</a>.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Template:Team:Aberdeen_Scotland/CSSTemplate:Team:Aberdeen Scotland/CSS2014-10-18T01:09:50Z<p>Kgizdov: </p>
<hr />
<div>/* REMOVE WIKI STYLING */<br />
<br />
body, html, #globalWrapper, #content {<br />
background: transparent;<br />
margin: 0;<br />
padding: 0;<br />
border: 0 none transparent;<br />
font-size: 1em;<br />
width: auto;<br />
border-top: 1px solid transparent;<br />
margin-top: -1px;<br />
}<br />
<br />
#top-section {<br />
border: 0 none transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
li.selected a {<br />
border: 0 none transparent;<br />
color: transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
#menubar.left-menu li {<br />
color: transparent;<br />
}<br />
<br />
#top-section:hover #menubar * {<br />
color: blue !important;<br />
text-decoration: none;<br />
}<br />
<br />
#top-section:hover #menubar.left-menu {<br />
background: rgba(255, 255, 255, 0.75) !important;<br />
}<br />
#search-controls{<br />
height: 0px;<br />
display: none !important;<br />
}<br />
<br />
#content>p:first-child {<br />
margin: 0;<br />
height: 0;<br />
display: none;<br />
}<br />
<br />
.toc {<br />
display: none;<br />
}<br />
<br />
.editsection {<br />
display: none;<br />
}<br />
<br />
<br />
#contentSub, #footer-box, #sitesub, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading, .visualClear {display: none;}<br />
<br />
/* END OF STYLING REMOVAL*/<br />
<br />
<br />
#top, .firstHeading {<br />
display: none;<br />
}<br />
<br />
<br />
<br />
body {<br />
background: #8B2942; /*E6E6E6*/<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
}<br />
<br />
table {<br />
color: #8B2942 !important;<br />
}<br />
<br />
.pg_break {<br />
clear: both;<br />
border: 1px dotted #8B2942;<br />
}<br />
<br />
.fl_left {<br />
float: left;<br />
margin-right: 15px;<br />
}<br />
<br />
* {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
a {<br />
margin: 0px;<br />
padding: 0px;<br />
text-decoration: none;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
list-style: none;<br />
}<br />
<br />
#wrapper{<br />
background: #8B2942;<br />
width: 975px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
<br />
#wrapper h1, h2, h3, h4, h5, h6 {<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
border: none;<br />
}<br />
<br />
#header {<br />
width: auto;<br />
margin: auto;<br />
}<br />
<br />
.logo a {<br />
background-image: url(https://static.igem.org/mediawiki/2014/5/51/Head.png);<br />
background-repeat: no-repeat;<br />
display: block;<br />
width: 975px;<br />
height: 327px;<br />
z-index: -1;<br />
}<br />
<br />
#navbar {<br />
margin-top: -33px;<br />
z-index: 1;<br />
}<br />
<br />
ul.navbar {<br />
float: center;<br />
margin: 0px;<br />
margin-left: 10px;<br />
padding: 0px;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
ul.navbar li {<br />
padding: 0px;<br />
margin: 0px;<br />
display: inline-block;<br />
float: left;<br />
}<br />
<br />
.navbar li a {<br />
float: left;<br />
margin-top: 3px;<br />
margin-bottom: 1px;<br />
padding-left: 12px;<br />
padding-right: 12px;<br />
font-family: "Calibri", tahoma, arial, sans-serif;<br />
font-size: 18px;<br />
color: #FFF;<br />
background: #8B2942;<br />
line-height: 30px;<br />
text-decoration: none;<br />
border-right: 1px dotted #FFF;<br />
}<br />
<br />
.navbar li a.Act {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
position: relative;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a.Act:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
#social {<br />
float: right;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f4/Blur.png);<br />
background-repeat: no-repeat;<br />
width: 114px;<br />
height: 30px;<br />
padding-top: 4px;<br />
display: block;<br />
z-index: 1;<br />
}<br />
<br />
ul.social {<br />
display: block;<br />
}<br />
<br />
.social li a {<br />
float: right;<br />
margin-right: 12px;<br />
width: 22px;<br />
height: 22px;<br />
display: inline-block;<br />
}<br />
<br />
.social li a:hover {<br />
position: relative;<br />
margin-top: -2px;<br />
margin-left: -1px;<br />
margin-right: 13px;<br />
}<br />
<br />
.social li a:hover img {<br />
display: block;<br />
width: 23px;<br />
height: 23px;<br />
}<br />
<br />
#pcontent {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: -1px;<br />
z-index: 1;<br />
display: inline-block;<br />
}<br />
<br />
#sidebar {<br />
background: #8B2942;<br />
float: left;<br />
margin: 0;<br />
width: 150px;<br />
display: inline-block;<br />
}<br />
<br />
.sidebar {<br />
display: block;<br />
height: 100%;<br />
}<br />
<br />
.sidebar li {<br />
display: block;<br />
background: #8B2942;<br />
color: #FFF;<br />
margin: 0;<br />
padding: 0;<br />
padding-top: 3px;<br />
padding-bottom: 3px;<br />
}<br />
<br />
.sidebar li.curr {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li.curr:hover {<br />
<br />
}<br />
<br />
.sidebar li a {<br />
display: block;<br />
color: #FFF;<br />
margin-left: 3px;<br />
padding-left: 20px;<br />
width: 125px;<br />
text-decoration: none;<br />
border-left: 2px solid #FFF;<br />
}<br />
<br />
.sidebar li a:hover {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr:hover {<br />
<br />
}<br />
<br />
#container {<br />
clear: right;<br />
float: right;<br />
width: 775px;<br />
padding-left: 25px;<br />
padding-right: 25px;<br />
display: inline-block;<br />
}<br />
<br />
#container img {<br />
max-width: 775px;<br />
}<br />
<br />
.t_overview {<br />
display: block;<br />
float: left;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.t_overview h1 {<br />
padding-top: 1px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.t_overview p {<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
}<br />
<br />
ul.back_button {<br />
display: inline-block;<br />
}<br />
<br />
ul.back_button li {<br />
margin: 10px;<br />
}<br />
<br />
.back_button li a {<br />
padding-top: 6px;<br />
padding-bottom: 6px;<br />
padding-left: 7px;<br />
padding-right: 7px;<br />
text-decoration: none;<br />
color: #FFF;<br />
background: #8B2942;<br />
border: 2px solid #8B2942;<br />
}<br />
<br />
.back_button li a:hover {<br />
color: #8B2942;<br />
background: #FFF;<br />
}<br />
<br />
.external {<br />
display: block;<br />
float: left;<br />
}<br />
<br />
.main_content {<br />
text-align: justify;<br />
text-justify: inter-word;<br />
}<br />
<br />
.main_content p {<br />
text-indent: 50px;<br />
margin-top: 16px;<br />
margin-bottom: 16px;<br />
}<br />
<br />
.main_content ul {<br />
padding-left: 25px;<br />
}<br />
<br />
.main_content ol {<br />
padding-right: 25px;<br />
}<br />
<br />
#member {<br />
<br />
}<br />
<br />
div#member {<br />
width: 100%;<br />
float: left;<br />
display: block;<br />
}<br />
<br />
#member div {<br />
display: block;<br />
}<br />
<br />
#members {<br />
<br />
}<br />
<br />
img.prof_pic {<br />
float: right;<br />
height: auto;<br />
max-width: 190px !important;<br />
margin-left: 25px;<br />
margin-right: 25px;<br />
margin-bottom: 5px;<br />
margin-top: 0px;<br />
}<br />
<br />
#member img {<br />
<br />
}<br />
<br />
.name {<br />
float: left;<br />
margin: auto;<br />
padding: 15px;<br />
}<br />
<br />
.member_descr {<br />
margin: auto;<br />
margin-bottom: 25px;<br />
text-align: justify;<br />
}<br />
<br />
.member_descr h2 {<br />
margin-top: 0px;<br />
font-size: 20px;<br />
font-weight: bold;<br />
text-indent: 25px;<br />
}<br />
<br />
.member_descr p {<br />
text-indent: 25px;<br />
<br />
}<br />
<br />
.clear {<br />
clear: both;<br />
}<br />
<br />
#footer {<br />
background: #FFF;<br />
color: #8B2942;<br />
width: 975px;<br />
margin-top: 0px;<br />
display: inline-block;<br />
}<br />
<br />
.sponsors {<br />
padding-top: 15px;<br />
padding-bottom: 15px;<br />
}<br />
<br />
.sponsors li a img {<br />
width: 150px;<br />
}<br />
<br />
.attributions {<br />
margin-top: 20px;<br />
width: 100%;<br />
/*display: block;*/<br />
}<br />
<br />
.attributions li a img {<br />
display: block;<br />
max-width: 200px;<br />
max-height: 80px;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.at_name {<br />
text-decoration: none;<br />
line-height: 20px;<br />
float: right;<br />
}<br />
<br />
.float {<br />
margin-top: 25px;<br />
margin-bottom: 25px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 90%;<br />
}<br />
<br />
.center {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 60%;<br />
}<br />
<br />
.center img {<br />
max-width: 100% !important;<br />
}</div>Kgizdovhttp://2014.igem.org/Template:Team:Aberdeen_Scotland/CSSTemplate:Team:Aberdeen Scotland/CSS2014-10-18T01:03:18Z<p>Kgizdov: </p>
<hr />
<div>/* REMOVE WIKI STYLING */<br />
<br />
body, html, #globalWrapper, #content {<br />
background: transparent;<br />
margin: 0;<br />
padding: 0;<br />
border: 0 none transparent;<br />
font-size: 1em;<br />
width: auto;<br />
border-top: 1px solid transparent;<br />
margin-top: -1px;<br />
cursor: url("http://downloads.totallyfreecursors.com/cursor_files/fly.cur"), url("http://downloads.totallyfreecursors.com/thumbnails/fly.gif"), auto;<br />
}<br />
<br />
#top-section {<br />
border: 0 none transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
li.selected a {<br />
border: 0 none transparent;<br />
color: transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
#menubar.left-menu li {<br />
color: transparent;<br />
}<br />
<br />
#top-section:hover #menubar * {<br />
color: blue !important;<br />
text-decoration: none;<br />
}<br />
<br />
#top-section:hover #menubar.left-menu {<br />
background: rgba(255, 255, 255, 0.75) !important;<br />
}<br />
#search-controls{<br />
height: 0px;<br />
display: none !important;<br />
}<br />
<br />
#content>p:first-child {<br />
margin: 0;<br />
height: 0;<br />
display: none;<br />
}<br />
<br />
.toc {<br />
display: none;<br />
}<br />
<br />
.editsection {<br />
display: none;<br />
}<br />
<br />
<br />
#contentSub, #footer-box, #sitesub, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading, .visualClear {display: none;}<br />
<br />
/* END OF STYLING REMOVAL*/<br />
<br />
<br />
#top, .firstHeading {<br />
display: none;<br />
}<br />
<br />
<br />
<br />
body {<br />
background: #8B2942; /*E6E6E6*/<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
}<br />
<br />
table {<br />
color: #8B2942 !important;<br />
}<br />
<br />
.pg_break {<br />
clear: both;<br />
border: 1px dotted #8B2942;<br />
}<br />
<br />
.fl_left {<br />
float: left;<br />
margin-right: 15px;<br />
}<br />
<br />
* {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
a {<br />
margin: 0px;<br />
padding: 0px;<br />
text-decoration: none;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
list-style: none;<br />
}<br />
<br />
#wrapper{<br />
background: #8B2942;<br />
width: 975px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
<br />
#wrapper h1, h2, h3, h4, h5, h6 {<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
border: none;<br />
}<br />
<br />
#header {<br />
width: auto;<br />
margin: auto;<br />
}<br />
<br />
.logo a {<br />
background-image: url(https://static.igem.org/mediawiki/2014/5/51/Head.png);<br />
background-repeat: no-repeat;<br />
display: block;<br />
width: 975px;<br />
height: 327px;<br />
z-index: -1;<br />
}<br />
<br />
#navbar {<br />
margin-top: -33px;<br />
z-index: 1;<br />
}<br />
<br />
ul.navbar {<br />
float: center;<br />
margin: 0px;<br />
margin-left: 10px;<br />
padding: 0px;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
ul.navbar li {<br />
padding: 0px;<br />
margin: 0px;<br />
display: inline-block;<br />
float: left;<br />
}<br />
<br />
.navbar li a {<br />
float: left;<br />
margin-top: 3px;<br />
margin-bottom: 1px;<br />
padding-left: 12px;<br />
padding-right: 12px;<br />
font-family: "Calibri", tahoma, arial, sans-serif;<br />
font-size: 18px;<br />
color: #FFF;<br />
background: #8B2942;<br />
line-height: 30px;<br />
text-decoration: none;<br />
border-right: 1px dotted #FFF;<br />
}<br />
<br />
.navbar li a.Act {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
position: relative;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a.Act:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
#social {<br />
float: right;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f4/Blur.png);<br />
background-repeat: no-repeat;<br />
width: 114px;<br />
height: 30px;<br />
padding-top: 4px;<br />
display: block;<br />
z-index: 1;<br />
}<br />
<br />
ul.social {<br />
display: block;<br />
}<br />
<br />
.social li a {<br />
float: right;<br />
margin-right: 12px;<br />
width: 22px;<br />
height: 22px;<br />
display: inline-block;<br />
}<br />
<br />
.social li a:hover {<br />
position: relative;<br />
margin-top: -2px;<br />
margin-left: -1px;<br />
margin-right: 13px;<br />
}<br />
<br />
.social li a:hover img {<br />
display: block;<br />
width: 23px;<br />
height: 23px;<br />
}<br />
<br />
#pcontent {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: -1px;<br />
z-index: 1;<br />
display: inline-block;<br />
}<br />
<br />
#sidebar {<br />
background: #8B2942;<br />
float: left;<br />
margin: 0;<br />
width: 150px;<br />
display: inline-block;<br />
}<br />
<br />
.sidebar {<br />
display: block;<br />
height: 100%;<br />
}<br />
<br />
.sidebar li {<br />
display: block;<br />
background: #8B2942;<br />
color: #FFF;<br />
margin: 0;<br />
padding: 0;<br />
padding-top: 3px;<br />
padding-bottom: 3px;<br />
}<br />
<br />
.sidebar li.curr {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li.curr:hover {<br />
<br />
}<br />
<br />
.sidebar li a {<br />
display: block;<br />
color: #FFF;<br />
margin-left: 3px;<br />
padding-left: 20px;<br />
width: 125px;<br />
text-decoration: none;<br />
border-left: 2px solid #FFF;<br />
}<br />
<br />
.sidebar li a:hover {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr:hover {<br />
<br />
}<br />
<br />
#container {<br />
clear: right;<br />
float: right;<br />
width: 775px;<br />
padding-left: 25px;<br />
padding-right: 25px;<br />
display: inline-block;<br />
}<br />
<br />
#container img {<br />
max-width: 775px;<br />
}<br />
<br />
.t_overview {<br />
display: block;<br />
float: left;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.t_overview h1 {<br />
padding-top: 1px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.t_overview p {<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
}<br />
<br />
ul.back_button {<br />
display: inline-block;<br />
}<br />
<br />
ul.back_button li {<br />
margin: 10px;<br />
}<br />
<br />
.back_button li a {<br />
padding-top: 6px;<br />
padding-bottom: 6px;<br />
padding-left: 7px;<br />
padding-right: 7px;<br />
text-decoration: none;<br />
color: #FFF;<br />
background: #8B2942;<br />
border: 2px solid #8B2942;<br />
}<br />
<br />
.back_button li a:hover {<br />
color: #8B2942;<br />
background: #FFF;<br />
}<br />
<br />
.external {<br />
display: block;<br />
float: left;<br />
}<br />
<br />
.main_content {<br />
text-align: justify;<br />
text-justify: inter-word;<br />
}<br />
<br />
.main_content p {<br />
text-indent: 50px;<br />
margin-top: 16px;<br />
margin-bottom: 16px;<br />
}<br />
<br />
.main_content ul {<br />
padding-left: 25px;<br />
}<br />
<br />
.main_content ol {<br />
padding-right: 25px;<br />
}<br />
<br />
#member {<br />
<br />
}<br />
<br />
div#member {<br />
width: 100%;<br />
float: left;<br />
display: block;<br />
}<br />
<br />
#member div {<br />
display: block;<br />
}<br />
<br />
#members {<br />
<br />
}<br />
<br />
img.prof_pic {<br />
float: right;<br />
height: auto;<br />
max-width: 190px !important;<br />
margin-left: 25px;<br />
margin-right: 25px;<br />
margin-bottom: 5px;<br />
margin-top: 0px;<br />
}<br />
<br />
#member img {<br />
<br />
}<br />
<br />
.name {<br />
float: left;<br />
margin: auto;<br />
padding: 15px;<br />
}<br />
<br />
.member_descr {<br />
margin: auto;<br />
margin-bottom: 25px;<br />
text-align: justify;<br />
}<br />
<br />
.member_descr h2 {<br />
margin-top: 0px;<br />
font-size: 20px;<br />
font-weight: bold;<br />
text-indent: 25px;<br />
}<br />
<br />
.member_descr p {<br />
text-indent: 25px;<br />
<br />
}<br />
<br />
.clear {<br />
clear: both;<br />
}<br />
<br />
#footer {<br />
background: #FFF;<br />
color: #8B2942;<br />
width: 975px;<br />
margin-top: 0px;<br />
display: inline-block;<br />
}<br />
<br />
.sponsors {<br />
padding-top: 15px;<br />
padding-bottom: 15px;<br />
}<br />
<br />
.sponsors li a img {<br />
width: 150px;<br />
}<br />
<br />
.attributions {<br />
margin-top: 20px;<br />
width: 100%;<br />
/*display: block;*/<br />
}<br />
<br />
.attributions li a img {<br />
display: block;<br />
max-width: 200px;<br />
max-height: 80px;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.at_name {<br />
text-decoration: none;<br />
line-height: 20px;<br />
float: right;<br />
}<br />
<br />
.float {<br />
margin-top: 25px;<br />
margin-bottom: 25px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 90%;<br />
}<br />
<br />
.center {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 60%;<br />
}<br />
<br />
.center img {<br />
max-width: 100% !important;<br />
}</div>Kgizdovhttp://2014.igem.org/Template:Team:Aberdeen_Scotland/CSSTemplate:Team:Aberdeen Scotland/CSS2014-10-18T01:02:42Z<p>Kgizdov: </p>
<hr />
<div>/* REMOVE WIKI STYLING */<br />
<br />
body, html, #globalWrapper, #content {<br />
background: transparent;<br />
margin: 0;<br />
padding: 0;<br />
border: 0 none transparent;<br />
font-size: 1em;<br />
width: auto;<br />
border-top: 1px solid transparent;<br />
margin-top: -1px;<br />
cursor: url("fly.cur"), url("http://1.bp.blogspot.com/-kmpsyoAjkDA/UGBEOOAHsjI/AAAAAAAACn0/4O7cqFg1aaY/s1600/blogtariffFly_2.gif"), auto;<br />
}<br />
<br />
#top-section {<br />
border: 0 none transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
li.selected a {<br />
border: 0 none transparent;<br />
color: transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
#menubar.left-menu li {<br />
color: transparent;<br />
}<br />
<br />
#top-section:hover #menubar * {<br />
color: blue !important;<br />
text-decoration: none;<br />
}<br />
<br />
#top-section:hover #menubar.left-menu {<br />
background: rgba(255, 255, 255, 0.75) !important;<br />
}<br />
#search-controls{<br />
height: 0px;<br />
display: none !important;<br />
}<br />
<br />
#content>p:first-child {<br />
margin: 0;<br />
height: 0;<br />
display: none;<br />
}<br />
<br />
.toc {<br />
display: none;<br />
}<br />
<br />
.editsection {<br />
display: none;<br />
}<br />
<br />
<br />
#contentSub, #footer-box, #sitesub, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading, .visualClear {display: none;}<br />
<br />
/* END OF STYLING REMOVAL*/<br />
<br />
<br />
#top, .firstHeading {<br />
display: none;<br />
}<br />
<br />
<br />
<br />
body {<br />
background: #8B2942; /*E6E6E6*/<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
}<br />
<br />
table {<br />
color: #8B2942 !important;<br />
}<br />
<br />
.pg_break {<br />
clear: both;<br />
border: 1px dotted #8B2942;<br />
}<br />
<br />
.fl_left {<br />
float: left;<br />
margin-right: 15px;<br />
}<br />
<br />
* {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
a {<br />
margin: 0px;<br />
padding: 0px;<br />
text-decoration: none;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
list-style: none;<br />
}<br />
<br />
#wrapper{<br />
background: #8B2942;<br />
width: 975px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
<br />
#wrapper h1, h2, h3, h4, h5, h6 {<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
border: none;<br />
}<br />
<br />
#header {<br />
width: auto;<br />
margin: auto;<br />
}<br />
<br />
.logo a {<br />
background-image: url(https://static.igem.org/mediawiki/2014/5/51/Head.png);<br />
background-repeat: no-repeat;<br />
display: block;<br />
width: 975px;<br />
height: 327px;<br />
z-index: -1;<br />
}<br />
<br />
#navbar {<br />
margin-top: -33px;<br />
z-index: 1;<br />
}<br />
<br />
ul.navbar {<br />
float: center;<br />
margin: 0px;<br />
margin-left: 10px;<br />
padding: 0px;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
ul.navbar li {<br />
padding: 0px;<br />
margin: 0px;<br />
display: inline-block;<br />
float: left;<br />
}<br />
<br />
.navbar li a {<br />
float: left;<br />
margin-top: 3px;<br />
margin-bottom: 1px;<br />
padding-left: 12px;<br />
padding-right: 12px;<br />
font-family: "Calibri", tahoma, arial, sans-serif;<br />
font-size: 18px;<br />
color: #FFF;<br />
background: #8B2942;<br />
line-height: 30px;<br />
text-decoration: none;<br />
border-right: 1px dotted #FFF;<br />
}<br />
<br />
.navbar li a.Act {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
position: relative;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a.Act:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
#social {<br />
float: right;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f4/Blur.png);<br />
background-repeat: no-repeat;<br />
width: 114px;<br />
height: 30px;<br />
padding-top: 4px;<br />
display: block;<br />
z-index: 1;<br />
}<br />
<br />
ul.social {<br />
display: block;<br />
}<br />
<br />
.social li a {<br />
float: right;<br />
margin-right: 12px;<br />
width: 22px;<br />
height: 22px;<br />
display: inline-block;<br />
}<br />
<br />
.social li a:hover {<br />
position: relative;<br />
margin-top: -2px;<br />
margin-left: -1px;<br />
margin-right: 13px;<br />
}<br />
<br />
.social li a:hover img {<br />
display: block;<br />
width: 23px;<br />
height: 23px;<br />
}<br />
<br />
#pcontent {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: -1px;<br />
z-index: 1;<br />
display: inline-block;<br />
}<br />
<br />
#sidebar {<br />
background: #8B2942;<br />
float: left;<br />
margin: 0;<br />
width: 150px;<br />
display: inline-block;<br />
}<br />
<br />
.sidebar {<br />
display: block;<br />
height: 100%;<br />
}<br />
<br />
.sidebar li {<br />
display: block;<br />
background: #8B2942;<br />
color: #FFF;<br />
margin: 0;<br />
padding: 0;<br />
padding-top: 3px;<br />
padding-bottom: 3px;<br />
}<br />
<br />
.sidebar li.curr {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li.curr:hover {<br />
<br />
}<br />
<br />
.sidebar li a {<br />
display: block;<br />
color: #FFF;<br />
margin-left: 3px;<br />
padding-left: 20px;<br />
width: 125px;<br />
text-decoration: none;<br />
border-left: 2px solid #FFF;<br />
}<br />
<br />
.sidebar li a:hover {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr:hover {<br />
<br />
}<br />
<br />
#container {<br />
clear: right;<br />
float: right;<br />
width: 775px;<br />
padding-left: 25px;<br />
padding-right: 25px;<br />
display: inline-block;<br />
}<br />
<br />
#container img {<br />
max-width: 775px;<br />
}<br />
<br />
.t_overview {<br />
display: block;<br />
float: left;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.t_overview h1 {<br />
padding-top: 1px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.t_overview p {<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
}<br />
<br />
ul.back_button {<br />
display: inline-block;<br />
}<br />
<br />
ul.back_button li {<br />
margin: 10px;<br />
}<br />
<br />
.back_button li a {<br />
padding-top: 6px;<br />
padding-bottom: 6px;<br />
padding-left: 7px;<br />
padding-right: 7px;<br />
text-decoration: none;<br />
color: #FFF;<br />
background: #8B2942;<br />
border: 2px solid #8B2942;<br />
}<br />
<br />
.back_button li a:hover {<br />
color: #8B2942;<br />
background: #FFF;<br />
}<br />
<br />
.external {<br />
display: block;<br />
float: left;<br />
}<br />
<br />
.main_content {<br />
text-align: justify;<br />
text-justify: inter-word;<br />
}<br />
<br />
.main_content p {<br />
text-indent: 50px;<br />
margin-top: 16px;<br />
margin-bottom: 16px;<br />
}<br />
<br />
.main_content ul {<br />
padding-left: 25px;<br />
}<br />
<br />
.main_content ol {<br />
padding-right: 25px;<br />
}<br />
<br />
#member {<br />
<br />
}<br />
<br />
div#member {<br />
width: 100%;<br />
float: left;<br />
display: block;<br />
}<br />
<br />
#member div {<br />
display: block;<br />
}<br />
<br />
#members {<br />
<br />
}<br />
<br />
img.prof_pic {<br />
float: right;<br />
height: auto;<br />
max-width: 190px !important;<br />
margin-left: 25px;<br />
margin-right: 25px;<br />
margin-bottom: 5px;<br />
margin-top: 0px;<br />
}<br />
<br />
#member img {<br />
<br />
}<br />
<br />
.name {<br />
float: left;<br />
margin: auto;<br />
padding: 15px;<br />
}<br />
<br />
.member_descr {<br />
margin: auto;<br />
margin-bottom: 25px;<br />
text-align: justify;<br />
}<br />
<br />
.member_descr h2 {<br />
margin-top: 0px;<br />
font-size: 20px;<br />
font-weight: bold;<br />
text-indent: 25px;<br />
}<br />
<br />
.member_descr p {<br />
text-indent: 25px;<br />
<br />
}<br />
<br />
.clear {<br />
clear: both;<br />
}<br />
<br />
#footer {<br />
background: #FFF;<br />
color: #8B2942;<br />
width: 975px;<br />
margin-top: 0px;<br />
display: inline-block;<br />
}<br />
<br />
.sponsors {<br />
padding-top: 15px;<br />
padding-bottom: 15px;<br />
}<br />
<br />
.sponsors li a img {<br />
width: 150px;<br />
}<br />
<br />
.attributions {<br />
margin-top: 20px;<br />
width: 100%;<br />
/*display: block;*/<br />
}<br />
<br />
.attributions li a img {<br />
display: block;<br />
max-width: 200px;<br />
max-height: 80px;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.at_name {<br />
text-decoration: none;<br />
line-height: 20px;<br />
float: right;<br />
}<br />
<br />
.float {<br />
margin-top: 25px;<br />
margin-bottom: 25px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 90%;<br />
}<br />
<br />
.center {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 60%;<br />
}<br />
<br />
.center img {<br />
max-width: 100% !important;<br />
}</div>Kgizdovhttp://2014.igem.org/Template:Team:Aberdeen_Scotland/CSSTemplate:Team:Aberdeen Scotland/CSS2014-10-18T01:01:45Z<p>Kgizdov: </p>
<hr />
<div>/* REMOVE WIKI STYLING */<br />
<br />
body, html, #globalWrapper, #content {<br />
background: transparent;<br />
margin: 0;<br />
padding: 0;<br />
border: 0 none transparent;<br />
font-size: 1em;<br />
width: auto;<br />
border-top: 1px solid transparent;<br />
margin-top: -1px;<br />
cursor: url("http://downloads.totallyfreecursors.com/cursor_files/fly.cur"), url("http://1.bp.blogspot.com/-kmpsyoAjkDA/UGBEOOAHsjI/AAAAAAAACn0/4O7cqFg1aaY/s1600/blogtariffFly_2.gif"), auto;<br />
}<br />
<br />
#top-section {<br />
border: 0 none transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
li.selected a {<br />
border: 0 none transparent;<br />
color: transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
#menubar.left-menu li {<br />
color: transparent;<br />
}<br />
<br />
#top-section:hover #menubar * {<br />
color: blue !important;<br />
text-decoration: none;<br />
}<br />
<br />
#top-section:hover #menubar.left-menu {<br />
background: rgba(255, 255, 255, 0.75) !important;<br />
}<br />
#search-controls{<br />
height: 0px;<br />
display: none !important;<br />
}<br />
<br />
#content>p:first-child {<br />
margin: 0;<br />
height: 0;<br />
display: none;<br />
}<br />
<br />
.toc {<br />
display: none;<br />
}<br />
<br />
.editsection {<br />
display: none;<br />
}<br />
<br />
<br />
#contentSub, #footer-box, #sitesub, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading, .visualClear {display: none;}<br />
<br />
/* END OF STYLING REMOVAL*/<br />
<br />
<br />
#top, .firstHeading {<br />
display: none;<br />
}<br />
<br />
<br />
<br />
body {<br />
background: #8B2942; /*E6E6E6*/<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
}<br />
<br />
table {<br />
color: #8B2942 !important;<br />
}<br />
<br />
.pg_break {<br />
clear: both;<br />
border: 1px dotted #8B2942;<br />
}<br />
<br />
.fl_left {<br />
float: left;<br />
margin-right: 15px;<br />
}<br />
<br />
* {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
a {<br />
margin: 0px;<br />
padding: 0px;<br />
text-decoration: none;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
list-style: none;<br />
}<br />
<br />
#wrapper{<br />
background: #8B2942;<br />
width: 975px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
<br />
#wrapper h1, h2, h3, h4, h5, h6 {<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
border: none;<br />
}<br />
<br />
#header {<br />
width: auto;<br />
margin: auto;<br />
}<br />
<br />
.logo a {<br />
background-image: url(https://static.igem.org/mediawiki/2014/5/51/Head.png);<br />
background-repeat: no-repeat;<br />
display: block;<br />
width: 975px;<br />
height: 327px;<br />
z-index: -1;<br />
}<br />
<br />
#navbar {<br />
margin-top: -33px;<br />
z-index: 1;<br />
}<br />
<br />
ul.navbar {<br />
float: center;<br />
margin: 0px;<br />
margin-left: 10px;<br />
padding: 0px;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
ul.navbar li {<br />
padding: 0px;<br />
margin: 0px;<br />
display: inline-block;<br />
float: left;<br />
}<br />
<br />
.navbar li a {<br />
float: left;<br />
margin-top: 3px;<br />
margin-bottom: 1px;<br />
padding-left: 12px;<br />
padding-right: 12px;<br />
font-family: "Calibri", tahoma, arial, sans-serif;<br />
font-size: 18px;<br />
color: #FFF;<br />
background: #8B2942;<br />
line-height: 30px;<br />
text-decoration: none;<br />
border-right: 1px dotted #FFF;<br />
}<br />
<br />
.navbar li a.Act {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
position: relative;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a.Act:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
#social {<br />
float: right;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f4/Blur.png);<br />
background-repeat: no-repeat;<br />
width: 114px;<br />
height: 30px;<br />
padding-top: 4px;<br />
display: block;<br />
z-index: 1;<br />
}<br />
<br />
ul.social {<br />
display: block;<br />
}<br />
<br />
.social li a {<br />
float: right;<br />
margin-right: 12px;<br />
width: 22px;<br />
height: 22px;<br />
display: inline-block;<br />
}<br />
<br />
.social li a:hover {<br />
position: relative;<br />
margin-top: -2px;<br />
margin-left: -1px;<br />
margin-right: 13px;<br />
}<br />
<br />
.social li a:hover img {<br />
display: block;<br />
width: 23px;<br />
height: 23px;<br />
}<br />
<br />
#pcontent {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: -1px;<br />
z-index: 1;<br />
display: inline-block;<br />
}<br />
<br />
#sidebar {<br />
background: #8B2942;<br />
float: left;<br />
margin: 0;<br />
width: 150px;<br />
display: inline-block;<br />
}<br />
<br />
.sidebar {<br />
display: block;<br />
height: 100%;<br />
}<br />
<br />
.sidebar li {<br />
display: block;<br />
background: #8B2942;<br />
color: #FFF;<br />
margin: 0;<br />
padding: 0;<br />
padding-top: 3px;<br />
padding-bottom: 3px;<br />
}<br />
<br />
.sidebar li.curr {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li.curr:hover {<br />
<br />
}<br />
<br />
.sidebar li a {<br />
display: block;<br />
color: #FFF;<br />
margin-left: 3px;<br />
padding-left: 20px;<br />
width: 125px;<br />
text-decoration: none;<br />
border-left: 2px solid #FFF;<br />
}<br />
<br />
.sidebar li a:hover {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr:hover {<br />
<br />
}<br />
<br />
#container {<br />
clear: right;<br />
float: right;<br />
width: 775px;<br />
padding-left: 25px;<br />
padding-right: 25px;<br />
display: inline-block;<br />
}<br />
<br />
#container img {<br />
max-width: 775px;<br />
}<br />
<br />
.t_overview {<br />
display: block;<br />
float: left;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.t_overview h1 {<br />
padding-top: 1px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.t_overview p {<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
}<br />
<br />
ul.back_button {<br />
display: inline-block;<br />
}<br />
<br />
ul.back_button li {<br />
margin: 10px;<br />
}<br />
<br />
.back_button li a {<br />
padding-top: 6px;<br />
padding-bottom: 6px;<br />
padding-left: 7px;<br />
padding-right: 7px;<br />
text-decoration: none;<br />
color: #FFF;<br />
background: #8B2942;<br />
border: 2px solid #8B2942;<br />
}<br />
<br />
.back_button li a:hover {<br />
color: #8B2942;<br />
background: #FFF;<br />
}<br />
<br />
.external {<br />
display: block;<br />
float: left;<br />
}<br />
<br />
.main_content {<br />
text-align: justify;<br />
text-justify: inter-word;<br />
}<br />
<br />
.main_content p {<br />
text-indent: 50px;<br />
margin-top: 16px;<br />
margin-bottom: 16px;<br />
}<br />
<br />
.main_content ul {<br />
padding-left: 25px;<br />
}<br />
<br />
.main_content ol {<br />
padding-right: 25px;<br />
}<br />
<br />
#member {<br />
<br />
}<br />
<br />
div#member {<br />
width: 100%;<br />
float: left;<br />
display: block;<br />
}<br />
<br />
#member div {<br />
display: block;<br />
}<br />
<br />
#members {<br />
<br />
}<br />
<br />
img.prof_pic {<br />
float: right;<br />
height: auto;<br />
max-width: 190px !important;<br />
margin-left: 25px;<br />
margin-right: 25px;<br />
margin-bottom: 5px;<br />
margin-top: 0px;<br />
}<br />
<br />
#member img {<br />
<br />
}<br />
<br />
.name {<br />
float: left;<br />
margin: auto;<br />
padding: 15px;<br />
}<br />
<br />
.member_descr {<br />
margin: auto;<br />
margin-bottom: 25px;<br />
text-align: justify;<br />
}<br />
<br />
.member_descr h2 {<br />
margin-top: 0px;<br />
font-size: 20px;<br />
font-weight: bold;<br />
text-indent: 25px;<br />
}<br />
<br />
.member_descr p {<br />
text-indent: 25px;<br />
<br />
}<br />
<br />
.clear {<br />
clear: both;<br />
}<br />
<br />
#footer {<br />
background: #FFF;<br />
color: #8B2942;<br />
width: 975px;<br />
margin-top: 0px;<br />
display: inline-block;<br />
}<br />
<br />
.sponsors {<br />
padding-top: 15px;<br />
padding-bottom: 15px;<br />
}<br />
<br />
.sponsors li a img {<br />
width: 150px;<br />
}<br />
<br />
.attributions {<br />
margin-top: 20px;<br />
width: 100%;<br />
/*display: block;*/<br />
}<br />
<br />
.attributions li a img {<br />
display: block;<br />
max-width: 200px;<br />
max-height: 80px;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.at_name {<br />
text-decoration: none;<br />
line-height: 20px;<br />
float: right;<br />
}<br />
<br />
.float {<br />
margin-top: 25px;<br />
margin-bottom: 25px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 90%;<br />
}<br />
<br />
.center {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 60%;<br />
}<br />
<br />
.center img {<br />
max-width: 100% !important;<br />
}</div>Kgizdovhttp://2014.igem.org/Template:Team:Aberdeen_Scotland/CSSTemplate:Team:Aberdeen Scotland/CSS2014-10-18T00:58:43Z<p>Kgizdov: </p>
<hr />
<div>/* REMOVE WIKI STYLING */<br />
<br />
body, html, #globalWrapper, #content {<br />
background: transparent;<br />
margin: 0;<br />
padding: 0;<br />
border: 0 none transparent;<br />
font-size: 1em;<br />
width: auto;<br />
border-top: 1px solid transparent;<br />
margin-top: -1px;<br />
cursor: url("http://downloads.totallyfreecursors.com/cursor_files/fly.cur"), url("http://downloads.totallyfreecursors.com/thumbnails/fly.gif"), auto;<br />
}<br />
<br />
#top-section {<br />
border: 0 none transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
li.selected a {<br />
border: 0 none transparent;<br />
color: transparent;<br />
margin: auto;<br />
padding: 0;<br />
width: 975px;<br />
height: 1.5em;<br />
margin-bottom: -1.5em;<br />
text-decoration: none;<br />
}<br />
<br />
#menubar.left-menu li {<br />
color: transparent;<br />
}<br />
<br />
#top-section:hover #menubar * {<br />
color: blue !important;<br />
text-decoration: none;<br />
}<br />
<br />
#top-section:hover #menubar.left-menu {<br />
background: rgba(255, 255, 255, 0.75) !important;<br />
}<br />
#search-controls{<br />
height: 0px;<br />
display: none !important;<br />
}<br />
<br />
#content>p:first-child {<br />
margin: 0;<br />
height: 0;<br />
display: none;<br />
}<br />
<br />
.toc {<br />
display: none;<br />
}<br />
<br />
.editsection {<br />
display: none;<br />
}<br />
<br />
<br />
#contentSub, #footer-box, #sitesub, #catlinks, #search-controls, #p-logo, .printfooter, .firstHeading, .visualClear {display: none;}<br />
<br />
/* END OF STYLING REMOVAL*/<br />
<br />
<br />
#top, .firstHeading {<br />
display: none;<br />
}<br />
<br />
<br />
<br />
body {<br />
background: #8B2942; /*E6E6E6*/<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
}<br />
<br />
table {<br />
color: #8B2942 !important;<br />
}<br />
<br />
.pg_break {<br />
clear: both;<br />
border: 1px dotted #8B2942;<br />
}<br />
<br />
.fl_left {<br />
float: left;<br />
margin-right: 15px;<br />
}<br />
<br />
* {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
p {<br />
margin: 0px;<br />
padding: 0px;<br />
}<br />
<br />
a {<br />
margin: 0px;<br />
padding: 0px;<br />
text-decoration: none;<br />
}<br />
<br />
ul {<br />
margin: 0px;<br />
padding: 0px;<br />
list-style: none;<br />
}<br />
<br />
#wrapper{<br />
background: #8B2942;<br />
width: 975px;<br />
margin: auto;<br />
text-align: left;<br />
}<br />
<br />
#wrapper h1, h2, h3, h4, h5, h6 {<br />
color: #8B2942;<br />
font-family: Arial, Helvetica, sans-serif;<br />
border: none;<br />
}<br />
<br />
#header {<br />
width: auto;<br />
margin: auto;<br />
}<br />
<br />
.logo a {<br />
background-image: url(https://static.igem.org/mediawiki/2014/5/51/Head.png);<br />
background-repeat: no-repeat;<br />
display: block;<br />
width: 975px;<br />
height: 327px;<br />
z-index: -1;<br />
}<br />
<br />
#navbar {<br />
margin-top: -33px;<br />
z-index: 1;<br />
}<br />
<br />
ul.navbar {<br />
float: center;<br />
margin: 0px;<br />
margin-left: 10px;<br />
padding: 0px;<br />
text-align: center;<br />
display: block;<br />
}<br />
<br />
ul.navbar li {<br />
padding: 0px;<br />
margin: 0px;<br />
display: inline-block;<br />
float: left;<br />
}<br />
<br />
.navbar li a {<br />
float: left;<br />
margin-top: 3px;<br />
margin-bottom: 1px;<br />
padding-left: 12px;<br />
padding-right: 12px;<br />
font-family: "Calibri", tahoma, arial, sans-serif;<br />
font-size: 18px;<br />
color: #FFF;<br />
background: #8B2942;<br />
line-height: 30px;<br />
text-decoration: none;<br />
border-right: 1px dotted #FFF;<br />
}<br />
<br />
.navbar li a.Act {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
position: relative;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
.navbar li a.Act:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: 0px;<br />
border-bottom: 3px solid #FFF;<br />
}<br />
<br />
#social {<br />
float: right;<br />
background: url(https://static.igem.org/mediawiki/2014/f/f4/Blur.png);<br />
background-repeat: no-repeat;<br />
width: 114px;<br />
height: 30px;<br />
padding-top: 4px;<br />
display: block;<br />
z-index: 1;<br />
}<br />
<br />
ul.social {<br />
display: block;<br />
}<br />
<br />
.social li a {<br />
float: right;<br />
margin-right: 12px;<br />
width: 22px;<br />
height: 22px;<br />
display: inline-block;<br />
}<br />
<br />
.social li a:hover {<br />
position: relative;<br />
margin-top: -2px;<br />
margin-left: -1px;<br />
margin-right: 13px;<br />
}<br />
<br />
.social li a:hover img {<br />
display: block;<br />
width: 23px;<br />
height: 23px;<br />
}<br />
<br />
#pcontent {<br />
background: #FFF;<br />
color: #8B2942;<br />
margin-top: -1px;<br />
z-index: 1;<br />
display: inline-block;<br />
}<br />
<br />
#sidebar {<br />
background: #8B2942;<br />
float: left;<br />
margin: 0;<br />
width: 150px;<br />
display: inline-block;<br />
}<br />
<br />
.sidebar {<br />
display: block;<br />
height: 100%;<br />
}<br />
<br />
.sidebar li {<br />
display: block;<br />
background: #8B2942;<br />
color: #FFF;<br />
margin: 0;<br />
padding: 0;<br />
padding-top: 3px;<br />
padding-bottom: 3px;<br />
}<br />
<br />
.sidebar li.curr {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li:hover {<br />
background: #FFF;<br />
color: #8B2942;<br />
}<br />
<br />
.sidebar li.curr:hover {<br />
<br />
}<br />
<br />
.sidebar li a {<br />
display: block;<br />
color: #FFF;<br />
margin-left: 3px;<br />
padding-left: 20px;<br />
width: 125px;<br />
text-decoration: none;<br />
border-left: 2px solid #FFF;<br />
}<br />
<br />
.sidebar li a:hover {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr {<br />
color: #8B2942;<br />
border-left: 2px solid #8B2942;<br />
}<br />
<br />
.sidebar li a.curr:hover {<br />
<br />
}<br />
<br />
#container {<br />
clear: right;<br />
float: right;<br />
width: 775px;<br />
padding-left: 25px;<br />
padding-right: 25px;<br />
display: inline-block;<br />
}<br />
<br />
#container img {<br />
max-width: 775px;<br />
}<br />
<br />
.t_overview {<br />
display: block;<br />
float: left;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.t_overview h1 {<br />
padding-top: 1px;<br />
margin-bottom: 10px;<br />
}<br />
<br />
.t_overview p {<br />
margin-top: 5px;<br />
margin-bottom: 5px;<br />
}<br />
<br />
ul.back_button {<br />
display: inline-block;<br />
}<br />
<br />
ul.back_button li {<br />
margin: 10px;<br />
}<br />
<br />
.back_button li a {<br />
padding-top: 6px;<br />
padding-bottom: 6px;<br />
padding-left: 7px;<br />
padding-right: 7px;<br />
text-decoration: none;<br />
color: #FFF;<br />
background: #8B2942;<br />
border: 2px solid #8B2942;<br />
}<br />
<br />
.back_button li a:hover {<br />
color: #8B2942;<br />
background: #FFF;<br />
}<br />
<br />
.external {<br />
display: block;<br />
float: left;<br />
}<br />
<br />
.main_content {<br />
text-align: justify;<br />
text-justify: inter-word;<br />
}<br />
<br />
.main_content p {<br />
text-indent: 50px;<br />
margin-top: 16px;<br />
margin-bottom: 16px;<br />
}<br />
<br />
.main_content ul {<br />
padding-left: 25px;<br />
}<br />
<br />
.main_content ol {<br />
padding-right: 25px;<br />
}<br />
<br />
#member {<br />
<br />
}<br />
<br />
div#member {<br />
width: 100%;<br />
float: left;<br />
display: block;<br />
}<br />
<br />
#member div {<br />
display: block;<br />
}<br />
<br />
#members {<br />
<br />
}<br />
<br />
img.prof_pic {<br />
float: right;<br />
height: auto;<br />
max-width: 190px !important;<br />
margin-left: 25px;<br />
margin-right: 25px;<br />
margin-bottom: 5px;<br />
margin-top: 0px;<br />
}<br />
<br />
#member img {<br />
<br />
}<br />
<br />
.name {<br />
float: left;<br />
margin: auto;<br />
padding: 15px;<br />
}<br />
<br />
.member_descr {<br />
margin: auto;<br />
margin-bottom: 25px;<br />
text-align: justify;<br />
}<br />
<br />
.member_descr h2 {<br />
margin-top: 0px;<br />
font-size: 20px;<br />
font-weight: bold;<br />
text-indent: 25px;<br />
}<br />
<br />
.member_descr p {<br />
text-indent: 25px;<br />
<br />
}<br />
<br />
.clear {<br />
clear: both;<br />
}<br />
<br />
#footer {<br />
background: #FFF;<br />
color: #8B2942;<br />
width: 975px;<br />
margin-top: 0px;<br />
display: inline-block;<br />
}<br />
<br />
.sponsors {<br />
padding-top: 15px;<br />
padding-bottom: 15px;<br />
}<br />
<br />
.sponsors li a img {<br />
width: 150px;<br />
}<br />
<br />
.attributions {<br />
margin-top: 20px;<br />
width: 100%;<br />
/*display: block;*/<br />
}<br />
<br />
.attributions li a img {<br />
display: block;<br />
max-width: 200px;<br />
max-height: 80px;<br />
margin-bottom: 20px;<br />
}<br />
<br />
.at_name {<br />
text-decoration: none;<br />
line-height: 20px;<br />
float: right;<br />
}<br />
<br />
.float {<br />
margin-top: 25px;<br />
margin-bottom: 25px;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 90%;<br />
}<br />
<br />
.center {<br />
display: block;<br />
margin-left: auto;<br />
margin-right: auto;<br />
width: 60%;<br />
}<br />
<br />
.center img {<br />
max-width: 100% !important;<br />
}</div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_ScotlandTeam:Aberdeen Scotland2014-10-18T00:38:50Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- Include MathJax --><br />
<script type="text/javascript" src="http://cdn.mathjax.org/mathjax/latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland">Overview</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/DNA">DNA</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Aberdeen iGEM Team 2014</h1><br />
<h3>Wake up to the Sleeping Sickness</h3><br />
<br />
<br><br />
<img src="https://static.igem.org/mediawiki/2014/a/ae/Igem_logo_exp.png"><br />
<br><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<h3>Human African Trypanosomiasis – a Neglected Tropical Disease</h3><br />
<p>Trypanosoma brucei gambiense, the causative agent of Human African Trypanosomiasis (HAT) (commonly known as African Sleeping Sickness), infects 30,000 people<br />
worldwide, with 60 million at disease risk. Unrecognised, this disease is fatal, but accurate diagnosis, relying on detection of patient serum antibodies against two<br />
different trypanosomal antigens, Variable Surface Glycoprotein LiTat 1.3 and Variable Surface Glycoprotein LiTat 1.5, allows successful treatment.</p><br />
<img src="https://static.igem.org/mediawiki/2014/f/f0/Parasite.png"><br />
<h3>Our project and achievements</h3><br />
<p>We engineered autotransporters Antigen43 (Ag43) and Ice-Nucleation protein (INP) to successfully express surface epitopes in <i>E.coli</i>, that mimic the two different<br />
trypanosomal antigens. Therefore, we created standardised and user-friendly Ag43 and INP BioBricks ready for peptides of choice to be cloned in. Two <i>E.coli</i> strains<br />
were generated, each expressing a distinct surface epitope and either a quorum sensing sender or receiver module respectively. We delivered a proof-of-principle<br />
demonstration of our project, by showing that the quorum-based system is capable of detecting cell surface Ag43-FLAG ‘Receiver’ <i>E.coli</i> in an anti-FLAG bead pull-<br />
down. These ‘Receivers’ co-cultured with AHL-synthesising ‘Senders’ produced a strong –FLAG-tag dependent, AHL-inducible GFP response. This system if applied in a<br />
real life scenario could effectively diagnose a neglected tropical disease such as Trypanosomiasis, using patient serum-derived antibodies, with minimal facilities.<br />
</p><br />
<img src="https://static.igem.org/mediawiki/2014/e/e2/Diag.png"><br><br />
<h3>The user-friendly, portable, inexpensive GFP detection device</h3><br />
<p>We constructed a cheap, Raspberry Pi computer-controlled fluorimeter suitable for developing countries, showing it could detect QS fluorescence output. The<br />
detection device costs around $100 and could replace heavy and expensive microscopes, to make the detection system affordable to remote populations in Africa.</p><br />
<img src="https://static.igem.org/mediawiki/2014/7/71/GFP_detector.png"><br />
<h3>Novel applications</h3><br />
<p>This novel application to diagnose patient exposure to tropical pathogens integrates antigen display and quorum sensing to implement AND logic sensing. It<br />
facilitates cheap, simple diagnosis of neglected tropical diseases such as HAT. Future diagnosis kits can be constructed and modularized using the cheap and self-<br />
replenishing <i>E. coli</i> based detection system we created as a platform for displaying two different mimotopes. Mimotopes are shortened versions of real epitopes<br />
identified for a panel of diseases, all of which are currently stored in a universal database, available to everyone and known as MimoDB [http://immunet.cn/mimodb].<br />
Moreover, it was recently shown that upon heat-treatment of Ag43 autotransporter-foreign peptide complex at 60°C, a chimeric form of the expressed foreign protein<br />
can be isolated and remain fully active. The chimeric protein was then used to induce an immune response and to develop a novel vaccine for cancer therapy (Huang et<br />
al., 2014). Therefore, we suggest that further research can be done on Ag43-trypanosomal mimotope/ other mimotope complexes for a potential first vaccine for HAT/<br />
other diseases.</p><br />
<p><b>Reference:</b> Huang, F., Li, L., Liu, Q., Li, Y., Bai, R., Huang, Y., Zhao, H., Guo, J., Zhou, S., Wang, H. and others, (2014). Bacterial surface display of<br />
endoglin by antigen 43 induces antitumor effectiveness via bypassing immunotolerance and inhibition of angiogenesis. International Journal of Cancer, 134(8),<br />
pp.1981--1990.</p><br />
</div><br />
<br />
<div class="external"><br />
<p>You can find our official iGEM Registry Page <a href="https://igem.org/Team.cgi?year=2014&team_name=Aberdeen_Scotland">here</a>.</p><br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/File:Igem_logo_exp.pngFile:Igem logo exp.png2014-10-18T00:38:06Z<p>Kgizdov: </p>
<hr />
<div></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/SocialTeam:Aberdeen Scotland/Ethics/Social2014-10-18T00:35:04Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Social</h1><br />
<h3></h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<div class="g-page" data-width="240" data-href="//plus.google.com/u/0/106825238674841642988" data-rel="publisher"></div><br />
<br />
<!-- TWITTER --><br />
<a class="twitter-timeline" width="300" height="326" href="https://twitter.com/iGEM2014ABDN" data-widget-id="522522716868333568">Tweets by @iGEM2014ABDN</a><br />
<script>!function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0],p=/^http:/.test(d.location)?'http':'https';if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src=p+"://platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");</script><br />
<br />
<br />
<!-- FACEBOOK PAGE --><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=https%3A%2F%2Fwww.facebook.com%2FiGEM2014ABDN&amp;width=200&amp;height=326&amp;colorscheme=light&amp;show_faces=true&amp;header=true&amp;stream=false&amp;show_border=true" scrolling="no" frameborder="0" style="border:none; overflow:hidden; width:200px; height:326px;" allowTransparency="true"></iframe><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/SocialTeam:Aberdeen Scotland/Ethics/Social2014-10-18T00:34:27Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Social</h1><br />
<h3></h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<div class="g-page" data-width="240" data-href="//plus.google.com/u/0/106825238674841642988" data-rel="publisher"></div><br />
<br />
<!-- TWITTER --><br />
<a class="twitter-timeline" width="300" height="326" href="https://twitter.com/iGEM2014ABDN" data-widget-id="522522716868333568">Tweets by @iGEM2014ABDN</a><br />
<script>!function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0],p=/^http:/.test(d.location)?'http':'https';if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src=p+"://platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");</script><br />
<br />
<br />
<!-- FACEBOOK PAGE --><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=https%3A%2F%2Fwww.facebook.com%2FiGEM2014ABDN&amp;width=200&amp;height=299&amp;colorscheme=light&amp;show_faces=true&amp;header=true&amp;stream=false&amp;show_border=true" scrolling="no" frameborder="0" style="border:none; overflow:hidden; width:200px; height:299px;" allowTransparency="true"></iframe><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/SocialTeam:Aberdeen Scotland/Ethics/Social2014-10-18T00:33:29Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<h1>Social</h1><br />
<h3></h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<div class="g-page" data-width="240" data-href="//plus.google.com/u/0/106825238674841642988" data-rel="publisher"></div><br />
<br />
<!-- TWITTER --><br />
<a class="twitter-timeline" width="300" href="https://twitter.com/iGEM2014ABDN" data-widget-id="522522716868333568">Tweets by @iGEM2014ABDN</a><br />
<script>!function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0],p=/^http:/.test(d.location)?'http':'https';if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src=p+"://platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs");</script><br />
<br />
<br />
<!-- FACEBOOK PAGE --><br />
<iframe src="//www.facebook.com/plugins/likebox.php?href=https%3A%2F%2Fwww.facebook.com%2FiGEM2014ABDN&amp;width=200&amp;height=299&amp;colorscheme=light&amp;show_faces=true&amp;header=true&amp;stream=false&amp;show_border=true" scrolling="no" frameborder="0" style="border:none; overflow:hidden; width:200px; height:299px;" allowTransparency="true"></iframe><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdovhttp://2014.igem.org/Team:Aberdeen_Scotland/Ethics/IntrospectionTeam:Aberdeen Scotland/Ethics/Introspection2014-10-18T00:31:04Z<p>Kgizdov: </p>
<hr />
<div><html><br />
<head><br />
<br />
<!-- Charset --><br />
<meta charset="UTF-8"><br />
<br />
<title>Team:Aberdeen Scotland - 2014.ogem.org</title><br />
<br />
<!-- JavaScript --><br />
<script src="https://2014.igem.org/Template:Team:Aberdeen_Scotland/JS?action=raw&ctype=text/js"></script><br />
<br />
<!-- Include CSS --><br />
<link rel="stylesheet" type="text/css" href="https://2014.igem.org/Template:Team:Aberdeen_Scotland/CSS?action=raw&ctype=text/css"><br />
<br />
<!-- GOOGLE PLUS PAGE --><br />
<script src="https://apis.google.com/js/platform.js" async defer></script><br />
<br />
</head><br />
<body><br />
<div id="wrapper"><br />
<div id="header"><br />
<div class="logo"><br />
<a href="http://abdn.ac.uk" title="University of Aberdeen"></a><br />
</div><br />
<div id="navbar"><br />
<ul class="navbar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland">Home</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Team">Team</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Project">Project</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Parts">Parts</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Modeling">Modelling</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Notebook">Notebook</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Safety">Safety</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Attributions">Attributions</a></li><br />
<li><a class="Act" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Ethics & Outreach</a></li><br />
</ul><br />
<div id="social"><br />
<ul class="social"><br />
<li><a href="http://twitter.com/iGEM2014ABDN" title="Twitter"><img src="https://static.igem.org/mediawiki/2014/7/78/Tw_inv_22.png"></a></li><br />
<li><a href="http://plus.google.com/106825238674841642988" rel="publisher" title="Google+"><img src="https://static.igem.org/mediawiki/2014/4/45/G%2B22.png"></a></li><br />
<li><a href="http://www.facebook.com/iGEM2014ABDN" title="Facebook"><img src="https://static.igem.org/mediawiki/2014/3/35/Fb_icon_22.png"></a></li><br />
</ul><br />
</div><br />
</div><br />
<br />
</div> <br class="clear"> <!-- END OF HEADER --><br />
<br />
<div id="pcontent"><br />
<br class="clear"><br />
<!-- SIDEBAR --><br />
<div id="sidebar"><br />
<ul class="sidebar"><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics">Summary</a></li><br />
<li class="curr"><a class="curr" href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Introspection">Introspection</a></li><br />
<li><a href="https://2014.igem.org/Team:Aberdeen_Scotland/Ethics/Social">Social</a></li><br />
</ul><br />
</div><br />
<br />
<div id="container"><br />
<br />
<!-- SECTION HEAD --><br />
<div class="t_overview"><br />
<!-- <h1></h1> --><br />
<h3>Our Simplest Guidelines for Safe Work and Ethical Practices, if you plan on working on real parasites!</h3><br />
</div> <br class="clear"> <!-- END OF HEAD --><br />
<br />
<!-- PAGE CONTENT --><br />
<div class="main_content"><br />
<br />
<h4>Investigating samples from patients</h4><br />
<p>As every enthusiastic scientist, since we started working on Human African Trypanosomiasis, we wanted to reach the stage where we could test blood human samples with our integrated system, to investigate its efficiency and specificity in real patients. Therefore, we started contacting experts in the field, to understand more about possible problems and to seek advice. From that perspective, World Health Organization has been one of our biggest targets. After more research, we found out that WHO targeted HAT elimination as a public health problem by 2020. Also, in 2013 WHO and the Bill and Melinda Gates Foundation signed an agreement to support innovative strategies to eliminate the disease. To support that, they set up a specimen bank containing blood, serum, cerebrospinal fluid, saliva and urine from affected and unaffected people from endemic countries from Africa.</p><br />
<br />
<h4>Acting upon it!</h4><br />
<p>We completed a <a href="https://static.igem.org/mediawiki/2014/d/db/WHO_linked.pdf">form</a> to submit it to the organization. However, our naïve expectations were soon faced with reality after consulting our idea with one of the supervisors, Dr Berndt Muller, who further evaluated it with Aberdeen University Safety Committee. Unfortunately, we did not have the necessary training or the vaccinations required to work with real antigens. Even more, that could have exposed us to risk of infections, had we not checked it with qualified personnel before.</p><br />
<br />
<h4>Different approach</h4><br />
<p>Even though we felt disappointed, this experience taught us that ethical and safety issues are the basis of any scientific project and only by addressing those issues first, you can then be free to tackle the real scientific challenges. Our different approach was to design the project in the direction of a proof-of-concept idea and to find different ways through which we could get our project to the stage of a more real-life based assay and characterisation. Therfore, we did more literature research and contacted immediately two experts in the field of Human African Trypanosomiasis, Dr. Philippe Büscher, Head of the Unit of Parasite Diagnostics at Institute of Tropical Medicine Antwerp and Liesbeth Van Nieuwenhove, PhD Biology & Veterinarian. After explaining our project to them, we kindly asked them if they could provide us with antibodies against the most common trypanosomal antigens, VSG 1.3 and 1.5. They have been extremely understanding and helpful and they even sent more samples that we asked for, to allow us to test our novel trypanosomal detector. Thank you!</p><br />
<p>Unfortunately, 10 weeks did not allow us to test those tryapanosomal antibodies, as we wanted. Frustrating enough, we have both the mimotopes for trypanosomes and the antibodies provided in the -80°C freezer, waiting for a future Aberdeen Team to be tested.</p><br />
<br />
<h4>Influence on our project and advice for other iGEM teams</h4><br />
<p>We realized that our initial, enthusiastic plan of working with real trypanosome pathogens in the laboratory was not achievable, but we could say that it helped us develop a novel approach to tackle the same problem without any safety and ethical concern, by getting in contact with researchers that work on the disease, who are more than keen to offer help to undergraduates.</p><br />
<br />
<p>Moreover, we realized that people’s fear for synthetic biology and genetic engineering sometimes expands beyond boundaries. Mass populations fear the evolvement of deadly viruses and random cloning, due to poor understanding of synthetic biology and scientific achievements. Therefore, we aimed to educate the public and we targeted different audiences: general public-short radio interview; more specialized public-publishing Blogposts on the Aberdeen University magazine website and giving a short presentation for the Explorathon European Researchers’ Night. Moreover, we presented our project both at the beginning and the end of the summer, by going to the iGEM Scottish Team Meeting and Synthetic Biology Conference in Edinburgh, respectively to Professor Muffy Calder, Chief Scientific Adviser for Scotland, at The Royal Society of Edinburgh. We also created an interactive DNA translating device, which could be used by a 10 year-old and we used social media (Facebook, Twitter and Goggle+ account) to advertise our project, iGEM and synthetic biology.</p><br />
<br />
<p>We encourage further iGEM teams to never give up on their project idea, because there are always safe and novel ways through which they can address it. Where there is a will, there is a way!</p><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
</div> <!-- END OF CONTAINER --><br />
<br />
</div> <br class="clear"> <!-- END OF PAGE CONTENT --><br />
<br />
<div id="footer"><br />
<br />
<ul class="sponsors"><br />
<li><a href="http://www.abdn.ac.uk/" title="University of Aberdeen"><img src="https://static.igem.org/mediawiki/2014/c/c6/Uni_of_ab.png"></a></li><br />
<li><a href="http://www.bbsrc.ac.uk/" title="BBSRC"><img src="https://static.igem.org/mediawiki/2014/a/a9/Bbsrc.png"></a></li><br />
<li><a href="http://www.biochemistry.org" title="Biochemical Society"><img src="https://static.igem.org/mediawiki/2014/7/7c/Biochem_soc.png"></a></li><br />
<li><a href="http://www.sgm.ac.uk/" title="Society for General Microbiology"><img src="https://static.igem.org/mediawiki/2014/f/f5/Soc_general_microb.png"></a></li><br />
<li><a href="http://www.sulsa.ac.uk/" title="SULSA"><img src="https://static.igem.org/mediawiki/2014/2/24/Sulsa.png"></a></li><br />
</ul><br />
<br />
</div> <!-- END OF FOOTER --><br />
</div> <!-- END OF PAGE WRAPPER--><br />
</body><br />
</html></div>Kgizdov