User contributions
From 2014.igem.org
(Latest | Earliest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)
- 05:04, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 05:02, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Project
- 04:51, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:49, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:45, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 04:44, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 04:43, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 03:17, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:16, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 02:00, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 01:56, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 01:53, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 01:49, 17 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 00:11, 17 October 2014 (diff | hist) N Troubleshooting12.9 (Created page with "<html> <p><b>Troubleshooting failed transformation of P.FAKS.humBeta.S:pD1214 into dH5alpha E. coli<br><br> Overview</b> <br><br> Of the September 12, 2014 transformations (gBl...") (top)
- 23:51, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 23:44, 16 October 2014 (diff | hist) Cloning7caesin (top)
- 23:43, 16 October 2014 (diff | hist) N Cloning7caesin (Created page with "<html> <br><p><b>Cloning 7 casein gBlocks</p><br> Cloning 7 casein gBlocks into pD1214, transforming into E. coli and extracting plasmid DNA</b> <br><br> Overview <br><br> Dur...")
- 23:05, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 22:54, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 22:53, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 22:46, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 22:45, 16 October 2014 (diff | hist) N File:20140701081646-vegan cheese team photo enhanced.jpg
- 21:12, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/AugustGrowthCurve (Created page with "<html> <p><b>GROWTH CURVE EXPERIMENT</b></p> <br> Chemical transformation of yeast requires the organism to be in logarithmic growth phase, so, before we clone our casein genes i...") (top)
- 21:00, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 20:40, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/AugustCloning (Created page with "<html> <p><b>Cloning human kappa casein into pD1214 vector, transforming to E. coli, plasmid preps and sequencing</b><br><br> <b>Experiment 082514_humKappaCasein(Kex+) Cloning</...")
- 20:05, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 19:59, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/NoteBookJune1 (Created page with "<html> <p><b>Experiment CR062214_hKappa Casein Cloning</b></p> The sequence has been delivered!<br> <ul> <li>5' - TACACGTACTTAGTCGCTGAAGCTCTTCT'''ATG'''GAAGTCCAAAACCAAAAGCAAC...") (top)
- 18:45, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 18:42, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/NotebookDocumentation (Created page with "<html> <br> <p><b>Real Vegan Cheese Notebook Documentation Guidelines</b><br> As important as it is to do experiments, it's just as important to document them. Not documenting o...") (top)
- 18:19, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Future Plans
- 18:19, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/Future Plans (Created page with "<html> <p><b>Future Plans<b><br> The Real Vegan Cheese team has successfully crowd source fundraised $37K and is committed to continuing the project. For the iGEM competition we...")
- 18:11, 16 October 2014 (diff | hist) N Team:SF Bay Area DIYbio/DNAhandling (Created page with "<html> <p><b>DNA Handling</b><br> Jump to: navigation, search<br> Our cloning strategy requires 20ng of Casein-DNA in 1uL. This means we need a final concentration of DNA for c...") (top)
- 18:08, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 17:31, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Safety
- 03:38, 16 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 04:47, 15 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 02:29, 15 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 18:33, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 04:23, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:06, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 04:03, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:54, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:52, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Notebook
- 03:41, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:27, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:26, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:10, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 03:07, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
- 02:26, 14 October 2014 (diff | hist) N File:Stages of vc v2.png (Horizontal RVC logo)
- 02:18, 14 October 2014 (diff | hist) Team:SF Bay Area DIYbio/Team
(Latest | Earliest) View (newer 50 | older 50) (20 | 50 | 100 | 250 | 500)